Recombinant Rat Fatty acid 2-hydroxylase (Fa2h)

What is Fatty Acid 2-Hydroxylase (Fa2h) and what is its primary function in rat neural tissue?

Fatty Acid 2-Hydroxylase (Fa2h) is an enzyme responsible for the synthesis of 2-hydroxy galactolipids in the nervous system, particularly in myelin. In rat neural tissue, Fa2h catalyzes the hydroxylation of fatty acids at the 2-position, which are then incorporated into galactolipids (galactosylceramide and sulfatide) during myelin formation . This 2-hydroxylation is crucial for tight lipid packing via hydrogen bonds at the membrane surface and enhances carbohydrate-carbohydrate interactions between galactolipids on apposing membranes . These structural modifications contribute significantly to myelin stability and function, with the 2-hydroxyl group altering the conformation of carbohydrate head groups to facilitate these interactions .

How does the expression and activity of Fatty Acid 2-Hydroxylase change during developmental myelination in rats?

Studies with rat sciatic nerves have demonstrated that both Fatty Acid 2-Hydroxylase mRNA expression and enzyme activity rapidly increase during developmental myelination . The content of 2-hydroxy fatty acids increases from approximately 5% of total galactolipid fatty acids at 4 days-of-age to 60% in galactosylceramide and 35% in sulfatides by 60 days-of-age . This pattern correlates with active myelination in the peripheral nervous system, as shown in the following developmental profile:

The chain length of galactolipid fatty acids also significantly increases during this period, reflecting the maturation of myelin structure .

What are the optimal storage and handling conditions for recombinant rat Fatty Acid 2-Hydroxylase protein?

For optimal activity maintenance of recombinant rat Fatty Acid 2-Hydroxylase, researchers should follow these storage and handling protocols :

• Store the protein at -20°C for routine storage, or at -80°C for extended storage periods

• The protein is typically supplied in a Tris-based buffer with 50% glycerol optimized for protein stability

• Avoid repeated freezing and thawing cycles, which significantly degrade enzyme activity

• Store working aliquots at 4°C for no longer than one week

• The protein is typically available in 50 μg quantities, with other sizes available for specialized applications

• When planning experiments, consider that the tag type on recombinant proteins is determined during the production process and should be verified for each batch

These storage conditions are critical for maintaining enzymatic activity for in vitro assays and functional studies .

What are the established methods for measuring Fatty Acid 2-Hydroxylase activity and expression in rat nervous system tissues?

Researchers can quantify Fatty Acid 2-Hydroxylase activity and expression using the following validated protocols:

For Fa2h activity measurement:

• Fatty Acid 2-Hydroxylase activity can be determined in rat sciatic nerves and in cultured cells like D6P2T cells using established assay methods

• The assay typically involves tissue homogenization followed by incubation with fatty acid substrates and analysis of 2-hydroxy fatty acid production

For expression analysis (qRT-PCR) :

• RNA isolation: Total RNA from sciatic nerves can be isolated using the QIAGEN RNeasy Lipid Tissue kit

• cDNA synthesis: Generate cDNA using commercial kits such as the Bio-Rad iScript cDNA Synthesis kit

• qPCR reaction setup:

  • Use rat-specific primers: rFA2H-F1 (cca tta cta cct gca ctt tgg) and rFA2H-R1 (tct gga atg agg gtg tgg a)

  • PCR reaction mixture: 15 μl iQ SYBR Green Supermix, cDNA template, and 200 nM each of forward and reverse primers in a total volume of 30 μL

  • Thermal cycling parameters: 95°C for 3 min, followed by 40 cycles of 10 sec at 95°C and 45 sec at 57°C

• Data analysis: Normalize to a reference gene such as 18S rRNA using primers r18S-F1 (ggc ccg aag cgt tta ctt) and r18S-R1 (cgg ccg tcc ctc tta atc)

These protocols allow for reliable quantification of both Fa2h activity and expression levels in experimental settings .

What genetic manipulation approaches are effective for studying Fatty Acid 2-Hydroxylase function in cellular and animal models?

Several genetic approaches have proven effective for studying Fa2h function:

1. RNA interference in cell culture :

• Short-hairpin RNA (shRNA) expression effectively silences Fatty Acid 2-Hydroxylase in Schwann cell cultures

• Effective siRNA sequences (e.g., aagagattattcacttgtggt) can be identified using tools like the Ambion siRNA Target Finder

• shRNA expression plasmids can be constructed with appropriate BamHI and HindIII linkers, loop sequences (ttcaagaga), and RNA Pol III terminators

• These constructs have been successfully used in D6P2T Schwannoma cells, reducing cellular 2-hydroxy fatty acids and 2-hydroxy galactosylceramide

2. Knockout mouse models :

• Two main strategies have been employed:
  a) Global knockout (Fa2h−/−): Generated using Cre-mediated germline deletion
  b) Cell-specific knockout (Fa2hflox/flox Cnp1-Cre): Fatty Acid 2-Hydroxylase deleted only in oligodendrocytes and Schwann cells

3. Genotyping protocols :

• For floxed alleles: PCR with primers 1 (ccagtactctggaggctaagg) and 2 (ctatatgtgcgtcggtgtttttc) yielding a 218 bp product

• For wild-type alleles: PCR with primers 3 (attgaacaagatggattgcac) and 4 (agccatgatggatactttctc) yielding a 345 bp product

These approaches allow for comprehensive analysis of Fatty Acid 2-Hydroxylase function in different experimental contexts, from cellular to whole-organism levels .

How does Fatty Acid 2-Hydroxylase expression correlate with Schwann cell differentiation and myelination?

Fatty Acid 2-Hydroxylase expression in cultured rat Schwann cells is highly regulated during differentiation, with several key findings demonstrating its role in myelination :

• Dibutyryl cyclic AMP treatment, which stimulates Schwann cell differentiation, dramatically upregulates Fatty Acid 2-Hydroxylase expression

• This upregulation coincides with the expression of other myelin genes, including:

  • CGT (ceramide galactosyltransferase)

  • Protein zero (P0, a major structural protein of peripheral myelin)

• The temporal expression pattern of Fatty Acid 2-Hydroxylase during development closely follows established myelination markers

What phenotypic differences exist between various Fatty Acid 2-Hydroxylase knockout mouse models?

Two main types of Fatty Acid 2-Hydroxylase knockout mouse models have been developed, each showing distinct phenotypes :

The observation that some CNS deficits in Fa2h−/− mice are not present in Fa2hflox/flox Cnp1-Cre mice indicates that Fatty Acid 2-Hydroxylase has important functions in the CNS beyond just the synthesis of myelin hFA-galactolipids . The relative sparing of the PNS suggests different requirements for 2-hydroxy galactolipids in peripheral versus central myelin, or the existence of compensatory mechanisms in the PNS.

What human neurological disorders are associated with mutations in the FA2H gene, and how do animal models recapitulate these conditions?

Mutations in the FA2H gene have been linked to several serious neurological disorders :

• Leukodystrophy: Characterized by progressive degeneration of white matter in the brain

• Spastic paraplegia: Featuring progressive stiffness and contraction of the lower limbs

• Neurodegeneration with brain iron accumulation: Including iron deposition in the brain and progressive neurological symptoms

Researchers have developed mouse models that recapitulate aspects of these human diseases . One notable approach involved creating a floxed Fa2h allele that, upon Cre-mediated recombination, replicates a pathogenic mutation identified in 7 patients (deletion of exons 5 and 6). These models show progressive nervous system dysfunction, highlighting the critical role of Fatty Acid 2-Hydroxylase in maintaining myelin integrity and neuronal function over time .

How does the absence of 2-hydroxy galactolipids mechanistically affect membrane biophysical properties and protein-lipid interactions in myelin?

Biophysical studies have shown that the 2-hydroxyl group in galactolipids facilitates tight lipid packing via hydrogen bonds and enhances carbohydrate-carbohydrate interactions between galactolipids on apposing membranes . Advanced research questions in this area include:

• How do these specific interactions influence:

  • The recruitment and organization of myelin proteins

  • The stability of myelin under various physiological and pathological stressors

  • The formation and maintenance of paranodal junctions and axo-glial contacts

• Methodological approaches to address these questions:

  • Atomic force microscopy to examine membrane physical properties

  • Fourier-transform infrared spectroscopy to analyze hydrogen bonding patterns

  • Biophysical measurements of membrane fluidity in model membranes with varying proportions of 2-hydroxy galactolipids

  • Protein-lipid interaction assays to determine binding affinities of myelin proteins to membranes with or without 2-hydroxy galactolipids

Understanding these mechanisms could provide insight into the molecular basis of the progressive demyelination observed in both Fatty Acid 2-Hydroxylase-deficient mice and human patients with FA2H mutations .

What is the relationship between Fatty Acid 2-Hydroxylase activity and Schwann cell migration during development and regeneration?

Fatty Acid 2-Hydroxylase-directed RNA interference has been shown to enhance migration of D6P2T Schwannoma cells, suggesting that 2-hydroxy lipids may influence the migratory properties of Schwann cells . This unexpected finding opens several research avenues:

• Investigation of signaling pathways affected by 2-hydroxy lipids:

  • Cell adhesion molecule expression and localization

  • Cytoskeletal dynamics and organization

  • Activation of Rho-family GTPases and other migration regulators

• Implications for developmental processes:

  • Neural crest migration and Schwann cell precursor movement

  • Radial sorting of axons during myelination

  • Establishment of proper myelin internodes and node spacing

• Potential role in nerve regeneration:

  • Schwann cell dedifferentiation and proliferation after injury

  • Migration to form bands of Büngner

  • Remyelination efficiency and quality after nerve damage

This unexpected relationship between Fa2h activity and cell migration suggests that beyond structural roles in myelin, 2-hydroxy lipids may act as signaling molecules or modulators of cell behavior during development and injury response .

What compensatory mechanisms might explain the differential vulnerability between central and peripheral nervous systems in Fatty Acid 2-Hydroxylase deficiency?

While CNS pathology is significant in Fa2h−/− mice, the peripheral nervous system appears relatively spared . This differential vulnerability raises important questions about potential compensatory mechanisms:

• Comparative analyses between CNS and PNS:

  • Transcriptomic profiling to identify differentially expressed genes

  • Lipidomic analyses to detect alternative lipid species that might compensate for the lack of 2-hydroxy galactolipids

  • Ultrastructural comparison of myelin periodicity and stability

• Investigation of alternative hydroxylation pathways:

  • Identification of other hydroxylases that might be upregulated in PNS but not CNS

  • Analysis of hydroxylated proteins or glycolipids that might serve similar functions

• Examination of differences in myelin maintenance:

  • Turnover rates of myelin components in CNS versus PNS

  • Different biophysical requirements for stability in each system

  • Variations in ion channel distribution and nodal organization

This research direction could provide valuable insights into fundamental differences between central and peripheral myelin, with implications for understanding the selective vulnerability of different neural tissues in various demyelinating diseases .