Recombinant Rat Neuropeptide Y receptor type 1 (Npy1r)

What cell types express Npy1r in rat retinal tissue?

Npy1r shows widespread expression across multiple retinal cell types in rats. Immunocytochemistry studies of rat retinal neural cell cultures prepared from newborn Wistar rats (P3-P5) have demonstrated that NPY Y1 receptors are present in:

• Neurons (including photoreceptors, bipolar, horizontal, amacrine, and ganglion cells)

• Macroglial cells (Müller cells and astrocytes)

• Microglial cells

Methodologically, researchers identified these cell types using specific markers combined with Y1 receptor immunostaining. This widespread distribution suggests that NPY signaling through Y1 receptors likely plays multiple roles in retinal physiology beyond what was previously understood .

How is Npy1r primarily characterized in terms of neurotransmitter systems?

Npy1r is predominantly expressed in excitatory neurons rather than inhibitory neurons in the central nervous system. Colocalization studies have demonstrated that Npy1r extensively colocalizes with the excitatory marker LIM homeobox transcription factor 1-β (Lmx1b) (96.91% ± 0.49%) but shows minimal colocalization with the inhibitory marker paired box 2 (Pax2) (only 1.39% ± 0.47%) .

This characterization is typically performed using:

• Double immunohistochemistry

• In situ hybridization

• Cell-type specific transcriptomics

These findings confirm that Y1 receptor-expressing interneurons (Y1-INs) are primarily glutamatergic in nature, providing important context for understanding their role in neural circuits .

What experimental mouse models are available for studying Npy1r function?

Several sophisticated mouse models have been developed to study Npy1r function:

Conditional Knockout Models:

• Npy1r^rfb mice: Created through a complex breeding strategy involving three different mouse lines:

  • Npy1r^2lox (containing loxP sites flanking Npy1r exons 2-3)

  • Tgα^CamKII-tTA (tetracycline-controlled transactivator under CamKII promoter)

  • Tg^LC1 (Cre recombinase expression system)

Reporter Lines:

• Npy1r-eGFP mouse line: Used to identify distinct neurophysiological firing patterns of Y1-expressing interneurons

Creating these models requires sophisticated genetic engineering approaches, including:

• Designing targeting vectors for homologous recombination in ES cells

• Introduction of loxP sites flanking critical exons

• Integration of frt-neo-frt cassettes

• Blastocyst injection and chimeric founder development

These models allow for temporal and spatial control of Npy1r expression, enabling precise investigation of its role in specific brain regions and developmental stages.

What are the basic protocols for measuring Npy1r mRNA expression in brain tissues?

Standard protocols for measuring Npy1r mRNA expression in brain tissues include:

In situ hybridization method:

• Generate Npy1r-specific RNA probes (489 bp) via PCR on cDNA using primers:

  • Y1R-FW: TTCTCCCTCCAGTGACACTC

  • Y1R-RV: GGAGACACATGACCGCAAC

• Section brain tissue at specific coordinates relative to Bregma:

  • Arcuate nucleus: -1.58 to -1.82 mm

  • PVN: -0.82 mm

  • Medial amygdala: -1.46 mm

  • Hippocampus: -1.70 to -1.94 mm

  • Dorsomedial nucleus: -1.70 mm

  • Basolateral amygdala: -1.58 to -1.70 mm

• Use 6-10 sections per mouse for accurate quantification

• Analyze relative mRNA levels using standardized imaging techniques

This methodology allows for precise quantification of regional Npy1r expression patterns and can detect changes in expression under various experimental conditions.

How does conditional inactivation of limbic Npy1r affect susceptibility to diet-induced obesity?

Conditional inactivation of Npy1r in limbic areas significantly affects metabolic regulation, with complex and somewhat counterintuitive outcomes:

Experimental Design:

• Npy1r^rfb mice (conditional Npy1r knockout in limbic areas) compared to Npy1r^2lox control littermates

• Exposure to standard diet (SD) vs. high-fat diet (HFD) for 3 weeks

• HFD composition: 45% kcal from fat, 5.2 kcal/g

• SD composition: 6.55% kcal from fat, 3.9 kcal/g

Key Findings:

• On standard diet: Npy1r^rfb mice showed decreased body weight growth and adipose tissue

• On high-fat diet: Npy1r^rfb mice displayed:

  • Increased body weight gain (observable after just 4 days of HFD)

  • Greater visceral adipose tissue accumulation

  • Elevated blood glucose levels

  • Hyperphagia, particularly during the first week of HFD exposure

  • Higher cumulative energy intake over the 3-week period

Metabolic Parameters Comparison (HFD exposure):

These findings suggest that limbic Npy1r plays a crucial role in adaptive responses to high-calorie diets, with its absence impairing habituation to high-caloric food and increasing susceptibility to diet-induced obesity and glucose intolerance .

What are the regional differences in Npy1r expression in response to high-fat diet exposure?

High-fat diet exposure induces region-specific changes in Npy1r expression, particularly in limbic structures:

Hippocampal Subregions:

Other Brain Regions:
No significant differences in Npy1r mRNA expression were observed in:

• Paraventricular nucleus (PVN)

• Dorsomedial hypothalamic nucleus (DM)

• Arcuate hypothalamic nucleus (Arc)

• Basolateral amygdala (BLA)

• Medial amygdala (MeA)

These differential responses suggest a complex regulatory mechanism for Npy1r expression that varies by brain region. The compensatory upregulation of Npy1r in CA1 and CA3 regions of Npy1r^rfb mice exposed to HFD likely reflects expression in non-glutamatergic cells, as the conditional knockout specifically targets excitatory neurons .

How do maternal care factors interact with Npy1r expression to influence metabolic phenotypes?

Maternal care quality significantly modulates the phenotypic effects of Npy1r gene manipulation:

Experimental Observation:

• Phenotypic differences between Npy1r^rfb and Npy1r^2lox mice are apparent only when pups are raised by foster dams exhibiting high levels of arched back nursing (HABN)

• HABN is an established index of high maternal (HM) care quality

Methodological Approach:

• Cross-fostering experiments with Swiss CD1 dams showing high maternal care profiles similar to FVB/J maternal behavior

• Careful monitoring of maternal behaviors including nursing positions and pup interactions

• Tracking developmental trajectories of body weight and metabolic parameters

Research Findings:

• Npy1r^rfb males reared by high-care CD1 dams showed:

  • Reduced hippocampal Npy1r mRNA expression

  • Slower body weight growth after PND 40 (postnatal day 40)

  • This timing coincides with maximal levels of Npy1r gene Cre-mediated inactivation

This complex interaction between genetic factors and early-life environment highlights the importance of considering maternal care as a critical variable in studies involving Npy1r manipulations. The data suggest epigenetic programming mechanisms that could influence lifelong metabolic regulation through Npy1r-mediated pathways .

What are the methodological considerations for distinguishing between different Npy1r-expressing neuronal subtypes?

Identifying and characterizing distinct Npy1r-expressing neuronal populations requires sophisticated methodological approaches:

Single-Cell Transcriptomics:

• Unbiased single-cell RNA sequencing has identified Npy1r expression in at least 3 distinct excitatory dorsal horn neuron clusters

• This approach allows for comprehensive classification based on genome-wide expression profiles

Transgenic Reporter Systems:

• The Npy1r-eGFP mouse line has been used to identify 4 distinct neurophysiological firing patterns of Y1-expressing interneurons

• BAC transgenic approaches (such as Grp-eGFP) can help identify overlapping neuron populations

Neurochemical Phenotyping:

• Recent approaches segregate excitatory interneurons into largely non-overlapping populations based on expression of specific markers:

  • CCK

  • Neurotensin

  • Neurokinin B (NKB)

  • Neuropeptide FF (NPFF)

  • Substance P (encoded by Tac1)

  • Gastrin-releasing peptide (Grp)

Co-localization Studies:

• Double-labeling immunohistochemistry with Npy1r and cell-type specific markers (Lmx1b for excitatory neurons, Pax2 for inhibitory neurons)

• This approach has confirmed that 96.91% (±0.49%) of Npy1r-expressing neurons co-express Lmx1b, while only 1.39% (±0.47%) co-express Pax2

These methodological approaches help distinguish between functionally distinct subpopulations of Npy1r-expressing neurons, which is essential for understanding their specific roles in neural circuits and behavior.

What are the most promising future research directions for Npy1r studies?

Based on current knowledge gaps and recent findings, several high-priority research directions emerge:

• Translational studies of Npy1r in pain modulation:

  • Recent evidence suggests Npy1r-expressing neurons may represent "a promising and precise pharmacotherapeutic target for the treatment of pain"

  • Developing selective agonists/antagonists targeting specific Npy1r-expressing neuronal populations

• Maternal care x Npy1r interactions:

  • Further investigation of epigenetic mechanisms by which maternal care influences Npy1r expression

  • Longitudinal studies tracking metabolic consequences of these early-life interactions

• Circuit-specific manipulation of Npy1r function:

  • Using advanced optogenetic and chemogenetic approaches to manipulate specific Npy1r-expressing neuronal populations

  • Circuit mapping to understand connectivity patterns of different Npy1r-expressing cell types

• Role in retinal physiology and pathology:

  • Given the widespread expression in retinal cells, investigating Npy1r function in visual processing, retinal development, and response to injury

  • Potential neuroprotective roles in retinal degenerative conditions

• Development of more precise genetic tools:

  • Creating intersectional genetic strategies to target specific subpopulations of Npy1r-expressing neurons

  • Cell-type specific CRISPR-based approaches for targeted manipulation of Npy1r expression

These research directions build on established knowledge while addressing current gaps in understanding Npy1r function across different physiological systems and disease states.

What standardized methods should researchers use when comparing Npy1r expression across different experimental models?

To ensure reproducibility and comparability of results, researchers should consider standardizing:

• Animal models and genetic background:

  • Explicitly report full genetic background information

  • Standard breeding protocols for generating conditional knockout models

  • Consistent foster care procedures when using cross-fostering approaches

• Expression analysis methods:

  • Standardized in situ hybridization protocols using validated probes

  • Consistent brain region sampling based on stereotaxic coordinates:

    • Arcuate nucleus: -1.58 to -1.82 mm from Bregma

    • PVN: -0.82 mm from Bregma

    • Hippocampus: -1.70 to -1.94 mm from Bregma

• Cell culture systems:

  • For retinal studies: standardized protocols for preparing rat retinal neural cell cultures from specific age ranges (P3-P5)

  • Consistent immunocytochemistry protocols for identifying cell types

• Metabolic phenotyping:

  • Standardized diet compositions:

    • HFD: 45% kcal from fat, 5.2 kcal/g

    • SD: 6.55% kcal from fat, 3.9 kcal/g

  • Glucose tolerance testing protocols with consistent fasting duration and glucose dose

• Environmental variables:

  • Recording and reporting housing conditions (temperature, light cycles)

  • Maternal care assessment using validated behavioral measures

  • Consistent age ranges for analyses