Recombinant Rat Probable palmitoyltransferase ZDHHC4 (Zdhhc4)

What is rat ZDHHC4 and what is its primary function in neuronal tissues?

Rat ZDHHC4 is a member of the zinc finger DHHC domain-containing protein family that functions as a palmitoyl acyltransferase. Its primary role involves catalyzing S-palmitoylation, a post-translational modification where palmitate is covalently attached to specific cysteine residues on target proteins. In neuronal tissues, particularly dorsal root ganglion (DRG) neurons, ZDHHC4 has been identified as a critical regulator of the transient receptor potential vanilloid 1 (TRPV1) ion channel, which is essential for pain sensation . ZDHHC4 directly interacts with TRPV1 and mediates its palmitoylation during inflammatory pain resolution, promoting TRPV1 degradation via the lysosomal pathway . This process represents a natural feedback mechanism that helps terminate inflammatory pain signals.

What experimental models are recommended for studying rat ZDHHC4 function?

Several validated experimental models are optimal for studying rat ZDHHC4 function:

These models enable comprehensive investigation of ZDHHC4's function from molecular mechanisms to behavioral outcomes. For optimal results, combining multiple models is recommended to validate findings across different experimental systems .

What methods are available for detecting ZDHHC4 expression and activity?

Multiple complementary techniques can be used to analyze ZDHHC4 expression and enzymatic activity:

Expression Analysis:

• mRNA quantification: RT-PCR and qPCR using validated primers (e.g., ZDHHC4-F: TCTACACAGTGGCTCTCCTGCT, ZDHHC4-R: AAAAGCAGCCCAGCACCACACA)

• Protein detection: Western blotting using specific antibodies against ZDHHC4

• Localization studies: Immunofluorescence microscopy with subcellular markers to visualize ZDHHC4 distribution

Activity Assessment:

• Acyl-Biotin Exchange (ABE) assay: The gold standard for detecting protein palmitoylation, involving:

  • Blocking free thiols with N-ethylmaleimide

  • Cleaving thioester bonds with hydroxylamine

  • Biotinylating newly exposed thiols

  • Enriching biotinylated proteins with streptavidin

  • Detecting targets by Western blotting

• Metabolic labeling: Using alkyne/azide-modified palmitate analogs for click chemistry detection

• Radioactive labeling: Incorporation of [³H]-palmitic acid for highly sensitive detection

Functional Readouts:

• Electrophysiology: Patch-clamp recording of TRPV1 currents in response to ZDHHC4 modulation

• Protein degradation assays: Monitoring TRPV1 protein levels to assess ZDHHC4-mediated degradation

How can rat ZDHHC4 be effectively expressed and purified for in vitro studies?

For optimal recombinant rat ZDHHC4 expression and purification:

• Expression Systems:

  • Mammalian cells (HEK293): Preferred for obtaining properly folded and post-translationally modified ZDHHC4; particularly useful when studying interactions with mammalian substrates

  • E. coli: Can be used for producing partial domains or peptides, though may lack proper folding of transmembrane domains

• Tags and Fusion Partners:

  • His-tag facilitates purification while minimally affecting protein function

  • Fc-Avi tags provide options for immobilization and detection

• Purification Strategy:

  • Solubilization with mild detergents (e.g., DDM, CHAPS) to preserve membrane protein integrity

  • Affinity chromatography using appropriate tag systems

  • Size exclusion chromatography for final polishing

• Quality Control:

  • Assess purity by SDS-PAGE (>80% purity is typically achievable)

  • Verify activity by in vitro palmitoylation assays

  • Check endotoxin levels (<1.0 EU per μg for cell-based applications)

• Storage:

  • Store in PBS buffer with 50% glycerol at -20°C for short-term use

  • For long-term storage, aliquot and maintain at -80°C to avoid freeze-thaw cycles

Commercially available recombinant rat ZDHHC4 proteins can serve as alternatives when resource constraints limit in-house production .

What specific cysteine residues on TRPV1 are palmitoylated by ZDHHC4 and how does this affect TRPV1 function?

ZDHHC4 catalyzes the palmitoylation of TRPV1 at four specific cysteine residues that were identified through comprehensive site-directed mutagenesis:

The quadruple cysteine mutant (4CA: C157A/362A/390A/715A) completely abolished ZDHHC4-mediated palmitoylation and protein downregulation, confirming these as the critical sites for ZDHHC4 action .

Functionally, ZDHHC4-mediated palmitoylation affects TRPV1 in several ways:

• Protein Stability: Palmitoylation promotes TRPV1 degradation via the lysosomal pathway, as evidenced by decreased TRPV1 protein levels both on the plasma membrane and in the cytosol when ZDHHC4 is overexpressed

• Channel Activity: Coexpression of ZDHHC4 significantly reduces TRPV1 current density in response to multiple stimuli:

  • Capsaicin (EC₅₀ and Hill coefficient unaffected)

  • Acid (pH sensitivity unaffected)

  • Heat (temperature threshold and Q₁₀ unaffected)

• Nocifensive Behavior: In vivo, ZDHHC4 knockdown enhanced pain responses to capsaicin, while overexpression reduced them, directly correlating with TRPV1 protein levels

Importantly, ZDHHC4 affects TRPV1 protein levels without altering channel sensitivity to agonists or temperature, suggesting that palmitoylation primarily regulates channel abundance rather than gating properties .

How is ZDHHC4 expression and activity regulated during inflammatory pain?

ZDHHC4 expression and activity undergo dynamic regulation during inflammatory pain, participating in a complex signaling network:

• Temporal Expression Pattern:
  In a carrageenan-induced inflammatory pain model, ZDHHC4 mRNA levels progressively increased over time (0, 12, and 24 hours post-inflammation), correlating with enhanced TRPV1 palmitoylation during the pain resolution phase .

• Signaling Pathway Regulation:
  The JAK2-STAT3 signaling pathway plays a crucial role in regulating ZDHHC4 expression. Inhibition of this pathway suppressed ZDHHC4 upregulation in response to inflammation, suggesting that inflammatory cytokines may trigger ZDHHC4 expression through JAK2-STAT3 activation .

• Feedback Loop Mechanism:
  A regulatory feedback loop exists where:

  • Inflammation initially increases TRPV1 activity

  • This triggers ZDHHC4 upregulation via JAK2-STAT3

  • ZDHHC4 then palmitoylates TRPV1, leading to its degradation

  • This process helps terminate inflammatory pain signals

• Counterbalancing Mechanisms:
  The depalmitoylase APT1 counteracts ZDHHC4 activity by removing palmitate from TRPV1, creating a dynamic equilibrium that fine-tunes TRPV1 levels. Knockdown of APT1 in vivo enhanced TRPV1 palmitoylation and degradation, reducing nocifensive behaviors .

• Cellular Localization Changes:
  During inflammation, there is increased colocalization of TRPV1 and ZDHHC4 in DRG neurons, facilitating their interaction and subsequent palmitoylation-mediated degradation of TRPV1 .

This regulatory network positions ZDHHC4 as a key player in the natural resolution of inflammatory pain, with potential implications for therapeutic intervention in chronic pain conditions.

How does ZDHHC4 substrate specificity compare to other ZDHHC family members?

ZDHHC4 demonstrates distinct substrate specificity compared to other ZDHHC family members:

• TRPV1 Specificity:
  Among all 23 ZDHHC family members whose mRNA was screened in DRG neurons, only ZDHHC4 physically interacted with TRPV1 and significantly downregulated its protein levels. This was confirmed by co-immunoprecipitation assays in HEK293T cells and native DRG neurons .

• Binding Domain Specificity:
  ZDHHC4 demonstrates selective interaction with specific domains of TRPV1:

  • Strong binding to the N-terminus (aa 1-432)

  • Strong binding to the C-terminus (aa 687-839)

  • Limited interaction with the transmembrane domains

• Comparison with Other ZDHHCs:
  While the search results don't provide comprehensive comparisons between ZDHHC4 and all family members, some insights on substrate specificity mechanisms can be derived from studies on related enzymes:

  ZDHHC Family Member	Known Substrates	Specificity Determinants
  ZDHHC4	TRPV1, potentially GSK3β	Direct protein-protein interaction
  ZDHHC14	PSD93, Kv1 channels	Direct binding and regulation of AIS targeting
  ZDHHC3/7/17	SNAP25, various substrates	Fatty acid chain length selectivity determined by TMD3

• Fatty Acid Selectivity:
  While not specifically characterized for ZDHHC4, studies on related ZDHHC enzymes (ZDHHC3, 7, and 17) revealed that single amino acid residues in the third transmembrane domain can determine fatty acid chain length selectivity. For example, a single I182S mutation in ZDHHC3 enhanced its ability to transfer longer chain fatty acids (C18:0) .

• Tissue-Specific Expression Patterns:
  ZDHHC enzymes show tissue-specific and cell-type-specific expression patterns within the nervous system, which likely contributes to their substrate specificities. For instance, ZDHHC4 shows specific expression patterns in DRG neurons, correlating with its role in pain regulation .

The remarkable specificity of ZDHHC4 for TRPV1 suggests that therapeutic approaches targeting this specific interaction might offer more selective modulation of pain pathways compared to broader palmitoylation inhibitors.

What methodological approaches are most effective for studying ZDHHC4-mediated protein palmitoylation in vivo?

Studying ZDHHC4-mediated palmitoylation in vivo requires sophisticated methodological approaches:

• Genetic Manipulation Strategies:

  Approach	Methodology	Advantages	Key Considerations
  shRNA Knockdown	AAV-delivered shRNA targeting ZDHHC4 (e.g., shRNA#1: GGTGCTCCACCTGTGACTTAA) administered intrathecally at L5-L6	Localized effect, maintains developmental compensations	Incomplete knockdown (~90%), potential off-target effects
  CRISPR/Cas9	Generation of conditional knockout models	Complete protein elimination, temporal control	Technical complexity, potential developmental effects
  Overexpression	AAV-mediated overexpression of wild-type or catalytically inactive ZDHHC4 (ΔDHHC mutant)	Tests gain-of-function effects	Non-physiological expression levels

• Dynamic Palmitoylation Assessment:

  Technique	Implementation	Applications
  In vivo ABE assay	Tissue harvest under specific conditions (e.g., pain models), followed by ABE protocol and Western blotting	Quantifies palmitoylation levels of specific targets in tissue samples
  Click chemistry imaging	In vivo administration of alkyne/azide-palmitate analogs followed by tissue fixation and click chemistry detection	Visualizes palmitoylation in tissue sections with spatial information
  Mass spectrometry	Tissue preparation for palmitoyl-proteomics using ABE or click chemistry enrichment followed by LC-MS/MS	Identifies novel palmitoylated targets in tissues

• Functional Readouts:

  Assay Type	Methodology	Measurement
  Pain behavior testing	- Von Frey filament test (mechanical allodynia) - Hargreaves test (thermal hyperalgesia) - Capsaicin-induced nocifensive behavior	Quantifies pain sensitivity changes resulting from ZDHHC4 manipulation
  Ex vivo electrophysiology	Patch-clamp recording of DRG neurons isolated from treated animals	Measures functional changes in TRPV1 activity
  Calcium imaging	In vivo calcium imaging of DRG neurons using GCaMP indicators	Visualizes neuronal activity in response to pain stimuli

• Temporal Analysis Approaches:

  Method	Implementation	Application
  Time-course studies	Sequential tissue collection at defined intervals after inflammatory stimulus (e.g., 0, 12, 24 hours)	Tracks dynamic changes in palmitoylation, protein levels, and gene expression
  Inducible expression systems	Tet-On/Off or tamoxifen-inducible Cre-loxP systems	Controls timing of ZDHHC4 manipulation

• Correlation Analysis:
  Correlating multiple parameters provides stronger mechanistic insights:

  • ZDHHC4 expression levels

  • Target protein palmitoylation levels

  • Target protein abundance

  • Functional outputs (electrophysiology)

  • Behavioral outcomes

These methodological approaches have successfully demonstrated that ZDHHC4 knockdown in vivo decreases TRPV1 palmitoylation, increases TRPV1 protein levels, enhances TRPV1 current density, and exacerbates pain behaviors in response to capsaicin .

What are the implications of ZDHHC4-mediated palmitoylation for developing novel pain therapeutics?

ZDHHC4-mediated palmitoylation represents a promising mechanism for developing novel pain therapeutics:

• Mechanistic Advantages for Drug Development:

  ZDHHC4 offers several attractive characteristics as a therapeutic target:

  • Specificity: Unlike broad-spectrum palmitoylation inhibitors, ZDHHC4 specifically targets TRPV1, potentially reducing off-target effects

  • Endogenous Regulatory Mechanism: ZDHHC4 represents a natural pain resolution mechanism that could be enhanced rather than blocked

  • Degradation vs. Inhibition: By promoting TRPV1 degradation rather than just inhibiting it, ZDHHC4-based therapies might avoid compensatory upregulation of TRPV1

  • Multiple Intervention Points: The ZDHHC4-TRPV1-APT1 axis offers several potential targets for therapeutic modulation

• Potential Therapeutic Strategies:

  Approach	Mechanism	Potential Advantages	Development Considerations
  ZDHHC4 activators	Enhance ZDHHC4 enzymatic activity	Direct enhancement of endogenous pain relief mechanism	Requires screening for specific activators
  ZDHHC4 expression enhancers	Increase ZDHHC4 protein levels	May provide sustained effect	Gene therapy approaches possible
  APT1 inhibitors	Block depalmitoylation of TRPV1	May extend TRPV1 palmitoylation state	ML348 and ML349 are available APT1 inhibitors
  Palmitoylation-mimetic TRPV1 binders	Small molecules that bind to palmitoylation sites	Could trigger TRPV1 degradation	Requires detailed structural information
  JAK2-STAT3 pathway modulators	Enhance ZDHHC4 expression via its regulatory pathway	Could use existing JAK/STAT modulators	May have broader effects beyond ZDHHC4

• Target Validation Evidence:

  In vivo manipulation of the ZDHHC4-APT1 axis has demonstrated clear effects on pain behaviors:

  • ZDHHC4 knockdown enhanced nocifensive responses to capsaicin

  • APT1 knockdown reduced nocifensive behaviors

  • These effects were absent in TRPV1-knockout mice, confirming specificity

• Beyond Inflammatory Pain:

  While current research focuses on inflammatory pain, the ZDHHC4-TRPV1 axis may have implications for other pain conditions:

  • Neuropathic pain, where TRPV1 is also implicated

  • Chronic pain conditions that involve central sensitization

  • Cancer pain, particularly in models where TRPV1 is upregulated

• Challenges and Future Directions:

  Several challenges need addressing:

  • Developing specific ZDHHC4 activators that can cross the blood-brain barrier

  • Understanding potential compensatory mechanisms in chronic conditions

  • Determining the broader palmitoylome of ZDHHC4 beyond TRPV1

  • Assessing long-term safety of ZDHHC4 modulation

The ZDHHC4-mediated palmitoylation pathway represents a novel mechanism that could complement existing pain management approaches by targeting an endogenous pain resolution process rather than simply blocking pain transmission .

How can contradictory findings regarding ZDHHC4 function be reconciled in the literature?

While the current research on ZDHHC4 is relatively consistent, researchers should be aware of potential sources of apparent contradictions:

By carefully considering these factors, researchers can better interpret apparently contradictory findings and develop a more complete understanding of ZDHHC4 function across different biological contexts.

What cutting-edge techniques are emerging for studying ZDHHC4-mediated palmitoylation?

Several cutting-edge techniques are advancing the study of ZDHHC4-mediated palmitoylation:

• Proximity-Based Labeling Approaches:

  Technique	Methodology	Applications for ZDHHC4 Research
  BioID/TurboID	ZDHHC4 fusion with biotin ligase to identify proximal proteins	Maps the ZDHHC4 interactome in living cells
  APEX2 proximity labeling	ZDHHC4-APEX2 fusion for electron microscopy and proteomics	High spatial resolution mapping of ZDHHC4 localization and interactions
  Split-BioID	Binary interactions with candidate substrates	Validates direct interactions in cellular context

• Advanced Imaging Technologies:

  Technique	Implementation	Research Value
  FLIM-FRET	Measure FRET between ZDHHC4 and substrates using fluorescence lifetime	Quantifies protein-protein interactions in live cells with high sensitivity
  Super-resolution microscopy	STORM/PALM imaging of ZDHHC4 and substrates	Reveals nanoscale organization at the plasma membrane
  Lattice light-sheet microscopy	3D imaging of ZDHHC4 dynamics	Captures rapid palmitoylation events with minimal phototoxicity

• Real-Time Monitoring of Palmitoylation:

  Approach	Methodology	Application
  Semi-synthetic probes	Integration of environment-sensitive fluorophores at palmitoylation sites	Real-time monitoring of palmitoylation status
  Genetically encoded biosensors	FRET-based sensors that detect conformational changes upon palmitoylation	Live-cell imaging of palmitoylation dynamics
  NanoBRET	Bioluminescence resonance energy transfer with optimized substrates	Highly sensitive detection of ZDHHC4-substrate interactions

• Structural Biology Approaches:

  Technique	Application to ZDHHC4	Research Value
  Cryo-EM	Structure determination of ZDHHC4 alone and in complex with substrates	Reveals molecular basis of substrate recognition
  HDX-MS	Hydrogen-deuterium exchange mass spectrometry	Maps conformational changes and interaction surfaces
  Integrative structural biology	Combines multiple structural techniques with computational modeling	Comprehensive structural models of ZDHHC4-substrate complexes

• Advanced Genetic Manipulation:

  Approach	Implementation	Advantage
  Base editing	Precise C→T or A→G substitutions to create specific mutations	Enables mutation of single palmitoylation sites without DSBs
  Prime editing	Programmable insertion, deletion, and substitution	Versatile editing of ZDHHC4 or substrate genes
  CRISPR activation/inhibition	CRISPRa/CRISPRi for endogenous gene regulation	Modulates expression without exogenous protein introduction

• Palmitoyl-Proteomics:

  Technique	Methodology	Application
  ABE-MS with SILAC/TMT	Quantitative proteomics to compare palmitoylation with/without ZDHHC4	Comprehensive identification of ZDHHC4 substrates
  ZDHHC4-specific inhibitor proteomics	Compare palmitoylomes with/without specific ZDHHC4 inhibition	Identifies direct ZDHHC4 substrates
  Site-specific palmitoyl-proteomics	MS techniques to identify exact sites of palmitoylation	Maps the precise sites on each substrate

These emerging techniques will enable more precise and comprehensive characterization of ZDHHC4's enzymatic activity, substrate specificity, and physiological functions, potentially revealing new therapeutic opportunities for modulating pain and other ZDHHC4-regulated processes.

How can common technical issues in ZDHHC4 expression and purification be resolved?

Researchers frequently encounter specific challenges when working with recombinant ZDHHC4:

When working with pre-coupled magnetic beads containing recombinant rat ZDHHC4 , additional considerations include:

• Store beads at 2-8°C and never freeze

• Maintain uniform suspension during dispensing

• Use appropriate blocking buffers to minimize non-specific binding

• Validate each new lot with positive and negative controls

What are the critical controls for validating ZDHHC4-mediated palmitoylation findings?

Rigorous validation of ZDHHC4-mediated palmitoylation requires multiple controls:

• Enzyme Activity Controls:

  Control Type	Implementation	Purpose
  Catalytic-dead mutant	ZDHHC4 with DHHC→DHHS mutation or DHHC domain deletion	Confirms requirement for catalytic activity
  Pharmacological inhibition	2-bromopalmitate (2-BP) treatment	Verifies palmitoylation dependence through chemical means
  Alternative ZDHHC enzymes	Test other ZDHHCs (e.g., ZDHHC2, 12, 15, 17, 18)	Establishes specificity of ZDHHC4 for target substrate

• Substrate Validation Controls:

  Control Type	Implementation	Purpose
  Cysteine-to-alanine mutations	Systematic mutation of potential palmitoylation sites	Identifies specific palmitoylation sites (e.g., C157, C362, C390, C715 in TRPV1)
  Non-substrate proteins	Test effects on other proteins (e.g., GAP43, ERK)	Confirms specificity of ZDHHC4 effect on target proteins
  Domain mapping	Truncated substrate proteins	Identifies domains required for ZDHHC4 interaction

• Technical Validation Controls:

  Control Type	Implementation	Purpose
  Hydroxylamine omission	Perform ABE assay without hydroxylamine treatment	Confirms thioester-specific labeling in ABE assays
  Multiple palmitoylation detection methods	Compare ABE, metabolic labeling, and click chemistry	Validates palmitoylation through independent methods
  Multiple shRNAs	Test independent shRNA sequences	Rules out off-target effects of RNA interference

• Functional Validation Controls:

  Control Type	Implementation	Purpose
  Knockout/knockdown specificity	Test effects in substrate-knockout models (e.g., TRPV1-KO mice)	Confirms substrate dependence of observed phenotypes
  Rescue experiments	Re-expression of wildtype or mutant proteins	Verifies specificity of knockdown phenotypes
  Depalmitoylase manipulation	APT1 knockdown or inhibition	Tests the dynamic regulation of palmitoylation

• Comprehensive Experimental Design Controls:

  Control Type	Implementation	Purpose
  Time-course analysis	Measurements at multiple timepoints	Captures dynamic changes in palmitoylation status
  Multiple readouts	Combine biochemical, electrophysiological, and behavioral assays	Ensures consistent effects across different levels of analysis
  Independent replication	Use different experimental systems and animals	Confirms robustness of findings

Implementing these controls has been essential in establishing the role of ZDHHC4 in TRPV1 palmitoylation, as demonstrated in the research by Wang et al. (2024) .

What are the most promising areas for future ZDHHC4 research?

Several high-potential research directions could significantly advance our understanding of ZDHHC4 biology:

• Comprehensive Substrate Identification:

  • Perform quantitative palmitoyl-proteomics comparing wild-type and ZDHHC4-knockout/knockdown tissues

  • Develop ZDHHC4-specific inhibitors as chemical biology tools

  • Investigate tissue-specific ZDHHC4 substrates beyond TRPV1 and GSK3β

• Structural Biology:

  • Determine the crystal or cryo-EM structure of ZDHHC4 alone and in complex with substrates

  • Map the substrate recognition domains and motifs

  • Structure-guided design of selective ZDHHC4 modulators

• Regulatory Network Mapping:

  • Elucidate the complete signaling pathways controlling ZDHHC4 expression and activity

  • Investigate the crosstalk between ZDHHC4 and depalmitoylases like APT1

  • Explore potential post-translational modifications of ZDHHC4 itself

• Therapeutic Development:

  • Screen for small molecule activators of ZDHHC4

  • Develop peptide-based inhibitors of specific ZDHHC4-substrate interactions

  • Design gene therapy approaches to modulate ZDHHC4 expression

• Expanded Physiological Roles:

  • Explore ZDHHC4 functions beyond pain regulation

  • Investigate developmental roles using conditional knockout models

  • Examine the role of ZDHHC4 in neurological and psychiatric disorders

• Technological Innovations:

  • Develop real-time sensors for monitoring ZDHHC4 activity in vivo

  • Create optogenetic tools to spatiotemporally control ZDHHC4 function

  • Establish in vitro reconstitution systems to study ZDHHC4 enzymatic mechanisms

These research directions could transform our understanding of ZDHHC4 biology and lead to novel therapeutic strategies for pain management and potentially other conditions.

How might research on ZDHHC4 intersect with other emerging fields in neuroscience?

ZDHHC4 research intersects with several cutting-edge areas in neuroscience:

• Neural Circuit Modulation:

  • ZDHHC4-mediated regulation of TRPV1 could influence nociceptive circuit function

  • Targeted manipulation of ZDHHC4 in specific neuronal populations could provide novel approaches for circuit-specific neuromodulation

  • Integration with optogenetic and chemogenetic approaches could enable precise spatiotemporal control of pain circuits

• Neuroinflammation and Neuroimmune Interactions:

  • ZDHHC4 regulation by the JAK2-STAT3 pathway links it to cytokine signaling

  • Potential role in mediating interactions between immune cells and nociceptors

  • Possible involvement in neuroinflammatory conditions beyond acute pain

• Neurodevelopmental Biology:

  • Potential roles in axon guidance and synapse formation based on findings with related ZDHHC enzymes

  • ZDHHC14 controls palmitoylation and axon initial segment clustering of PSD93 and Kv1 potassium channels

  • ZDHHC enzymes show distinct developmental expression patterns in the nervous system

• Neurological and Psychiatric Disorders:

  • Alterations in palmitoylation have been implicated in various neurological disorders

  • ZDHHC4 palmitoylation of GSK3β affects signaling pathways relevant to neurological conditions

  • Potential role in conditions involving TRPV1 dysregulation (e.g., certain forms of epilepsy)

• Precision Medicine Approaches:

  • Genetic variations in ZDHHC4 or its substrates might influence pain sensitivity

  • Personalized pain management strategies based on palmitoylation pathway profiling

  • Development of biomarkers for predicting pain chronification based on ZDHHC4 activity

• Artificial Intelligence and Computational Biology:

  • Machine learning approaches to predict novel ZDHHC4 substrates

  • Computational modeling of ZDHHC4-substrate interactions

  • Systems biology analysis of palmitoylation networks in pain regulation

By exploring these intersections, researchers can position ZDHHC4 studies within the broader context of neuroscience advances, potentially leading to transformative insights and applications.