Recombinant Rat Sodium/potassium-transporting ATPase subunit beta-2 (Atp1b2)

What is Atp1b2 and what is its primary function in cellular physiology?

Atp1b2 is the non-catalytic beta-2 subunit of the Na+/K+-ATPase enzyme complex which plays an essential role in maintaining appropriate ion balance within cells. This complex catalyzes the hydrolysis of ATP coupled with the exchange of sodium and potassium ions across the plasma membrane . This process is fundamental for cellular functions including neuronal signaling and muscle contraction . While the exact function of the beta-2 subunit specifically is not fully characterized, it is known to work with the catalytic alpha subunit to facilitate proper ion transport. Additionally, Atp1b2 mediates cell adhesion of neurons and astrocytes and promotes neurite outgrowth .

What is the expression pattern of Atp1b2 in rat tissues?

Atp1b2 shows a highly restricted tissue distribution pattern in rats. Western blot analysis has demonstrated that Atp1b2 is predominantly expressed in brain, pineal gland, and thymus . Notably, no Atp1b2 was detected in kidney, heart, spleen, liver, mammary gland, or lung . Within the brain, Atp1b2 is primarily associated with astrocytes, as evidenced by immunohistochemical staining showing Atp1b2 expression in glial cell profiles in the hippocampal CA1 region, specifically in the stratum radiatum and pyramidal layer . This restricted tissue distribution suggests important functional differences between beta subunit isoforms.

What is the structural composition of rat Atp1b2?

Rat Atp1b2 is composed of an approximately 32 kDa core protein modified with at least two N-linked carbohydrate chains, as revealed through treatment with N-glycanase F of rat brain microsomal membrane fractions . The protein contains a single transmembrane domain . Based on human ATP1B2, which shares high homology with rat Atp1b2, the protein consists of 290 amino acids . The rat Atp1b2 protein possesses an extracellular domain that contains the epitope recognized by specific antibodies, such as the sequence DTESWDQHVQKLNK corresponding to amino acid residues 99-112 .

How does Atp1b2 interact with other protein subunits in the Na+/K+-ATPase complex?

Atp1b2 preferentially binds to the ATP1A2 alpha subunit, which is mainly found in astrocytes after development completion . This specific interaction forms a functional Na+/K+-ATPase complex that is primarily involved in restoring extracellular K+ homeostasis following neuronal depolarization in astrocytes . The beta subunit is essential for proper folding, membrane insertion, and normal activity of the alpha subunit. Together, they form a complex that undergoes conformational changes during the ion transport cycle. Research has shown that Atp1b2 copurifies with ouabain-inhibitable Na+/K+-ATPase activity from rat brain, confirming it is a functional component of the rat brain Na+/K+-ATPase .

What methodologies are most effective for detecting and quantifying Atp1b2 expression in different experimental systems?

Several complementary techniques have proven effective for detecting and quantifying Atp1b2:

Western Blot Analysis: Particularly useful for analyzing Atp1b2 in tissue lysates, with specific antibodies targeting the extracellular domain providing reliable detection . Results are optimized when samples are treated with N-glycanase F to remove glycosylation that may interfere with antibody binding.

Immunohistochemistry: Effective for visualizing the spatial distribution of Atp1b2 in tissue sections. Perfusion-fixed frozen brain sections can be stained with anti-Beta 2 Na+/K+ ATPase antibodies followed by fluorescent secondary antibodies (e.g., AlexaFluor-488) .

Flow Cytometry: Useful for detecting Atp1b2 expression on live intact cells. Indirect flow cytometry using specific antibodies allows quantification of cell surface expression levels .

qPCR: For measuring Atp1b2 mRNA expression levels. The following primers have been verified for specificity and efficiency (99.8%): Forward: TGTGTTGGCAAGAGAGATGAAGA, Reverse: GGGTCACATTCAGGAACTTTACA .

RNA Interference: shRNA constructs can be used to validate the specificity of Atp1b2 detection methods. The most efficient shRNA construct reported knocked down mRNA expression by 57% and reduced Atp1b2-positive cells by 67% when analyzed by flow cytometry .

How is Atp1b2 expression altered in disease models and what significance does this have for CNS pathology research?

Atp1b2 has shown remarkably stable expression in multiple models of CNS injury and disease , making it a valuable marker for astrocyte research across various pathological conditions. This stability contrasts with other astrocyte markers that may change expression levels during reactive astrogliosis or other pathological processes.

The stable expression of Atp1b2 in disease models has led to its identification as the ACSA-2 epitope, which has become a valuable tool for astrocyte isolation and characterization in both healthy and disease conditions . This is particularly important because it allows researchers to study astrocytes without the need for specialized equipment, even in models of CNS injury and disease.

Recent studies have also implicated ATP1B2 (the human homolog) in cancer progression and metastasis, including gastric adenocarcinoma, suggesting a potential role beyond its traditional ion transport function . Understanding how Atp1b2 expression and function change in different disease contexts may provide insights into pathophysiological mechanisms and potential therapeutic targets.

How does post-translational modification affect Atp1b2 function and detection in experimental systems?

Atp1b2 undergoes significant post-translational modifications, primarily N-linked glycosylation. Treatment of rat brain microsomal membrane fractions with N-glycanase F revealed that Atp1b2 contains at least two N-linked carbohydrate chains attached to its approximately 32 kDa core protein . These modifications have important implications for both function and experimental detection:

Functional Implications:

• Glycosylation may influence protein folding and stability

• May affect the interaction with alpha subunits

• Could regulate cell-cell adhesion properties

• May protect the protein from proteolytic degradation

Experimental Detection Considerations:

• Glycosylation can mask epitopes, affecting antibody binding

• The three-dimensional structure of modified protein may differ from recombinant versions

• Native versus denatured states may expose different epitopes

• Experimental approaches may need modification to account for glycosylation

This is evidenced by observations that antibody recognition can differ between native and denatured states, as seen with chimeric constructs where "the epitope recognized by the anti-β1 antibody could thus be less accessible in the native ATP1B1-OD constructs but take on an open configuration after denaturation for Western blot analysis" . Similar considerations likely apply to Atp1b2 detection as well.

What are the optimal conditions for producing and purifying recombinant rat Atp1b2?

Based on protocols for human ATP1B2 which can be adapted for rat Atp1b2:

Expression System Selection:
HEK293 cells have proven effective for expressing functional recombinant ATP1B2 . This mammalian expression system provides appropriate post-translational modifications, particularly glycosylation, which is critical for proper folding and function.

Construct Design:

• Include a His-tag for purification purposes

• Express the fragment corresponding to amino acids 68-290 to exclude the transmembrane domain, which improves solubility

• Ensure signal peptide inclusion for proper membrane targeting if full-length protein is desired

Purification Protocol:

• Lyse cells in buffer containing appropriate detergents to solubilize membrane proteins

• Perform affinity chromatography using nickel columns to capture His-tagged protein

• Include wash steps with increasing imidazole concentrations

• Elute with high imidazole buffer

• Verify purity using SDS-PAGE (>95% purity should be achievable)

• Ensure endotoxin levels are controlled (<1 EU/μg)

Quality Control:

• Confirm identity using mass spectrometry or Western blotting

• Test functionality through binding assays with appropriate alpha subunits

• Verify glycosylation status through glycosidase treatment

How can researchers effectively use antibodies against Atp1b2 for various experimental applications?

The following methodological approaches have been validated for Atp1b2 antibody applications:

Western Blot Analysis:

• Optimal dilution: 1:200-1:400 for rat brain lysates

• Include appropriate blocking with a specific blocking peptide as a negative control

• Expected band size approximately 45-50 kDa (glycosylated form)

Immunohistochemistry:

• Use perfusion-fixed frozen brain sections

• Recommended dilution: 1:300

• Detection with fluorescently labeled secondary antibodies (e.g., goat anti-rabbit-AlexaFluor-488)

• Include DAPI for nuclear counterstaining

• Look for glial cell profiles in brain regions like hippocampal CA1

Flow Cytometry:

• Use 5μg antibody per sample for live intact cells

• Detect with appropriate secondary antibody (e.g., goat-anti-rabbit-FITC)

• Include proper negative controls (cells alone, cells with secondary antibody only)

Validation Approaches:

• Pre-incubate antibody with specific blocking peptide to confirm specificity

• Include multiple antibody clones targeting different epitopes when possible

• Use Atp1b2 knockdown cells as negative controls

What are the most reliable methods for Atp1b2 knockdown in experimental models?

Based on the search results, RNA interference has been successfully used for Atp1b2 knockdown:

shRNA Approach:
The most efficient shRNA construct reported (TL500159A) knocked down Atp1b2 mRNA expression by 57% compared to a scrambled control . This resulted in a 67% reduction in ACSA-2-positive cells as measured by flow cytometry .

Experimental Design Considerations:

• Include proper controls (scrambled shRNA constructs)

• Validate knockdown at both mRNA level (qPCR) and protein level (Western blot, flow cytometry)

• Test multiple shRNA constructs to identify the most efficient one

• Consider timing of analysis after knockdown induction

• Be aware that complete knockdown may be difficult to achieve or potentially lethal

Alternative Approaches:

• CRISPR/Cas9 genome editing for complete gene knockout in cell lines

• Conditional knockout models for in vivo studies

• Antisense oligonucleotides for transient knockdown

Validation Methods:

• qPCR to quantify mRNA reduction

• Western blot to assess protein levels

• Flow cytometry to measure cell surface expression

• Functional assays to determine physiological impact

What experimental protocols are recommended for studying Atp1b2-mediated astrocyte isolation and characterization?

The identification of Atp1b2 as the ACSA-2 epitope has enabled the development of immunoaffinity-based methods for isolating ultrapure adult astrocytes . The following protocol is recommended:

Astrocyte Isolation Protocol:

• Prepare a single-cell suspension from brain tissue using enzymatic digestion

• Remove myelin using density gradient centrifugation

• Incubate cells with anti-ACSA-2 (anti-Atp1b2) antibodies conjugated to magnetic microbeads

• Perform magnetic-activated cell sorting (MACS) to isolate Atp1b2-positive astrocytes

• Verify purity using flow cytometry with additional astrocyte markers

Advantages of this Method:

• Does not require specialized equipment beyond a magnetic separator

• Yields highly pure astrocyte populations

• Applicable to both healthy and disease model tissues

• Preserves cellular integrity for downstream applications

Verification of Isolated Astrocytes:

• Flow cytometry using additional astrocyte markers (GFAP, ALDH1L1, SLC1A3)

• qPCR analysis using the following primers :

  • Atp1b2: Forward TGTGTTGGCAAGAGAGATGAAGA, Reverse GGGTCACATTCAGGAACTTTACA (99.8% efficiency)

  • Slc1a3: Forward CCTGGGTTTTCATTGGAGGGTTG, Reverse GTGGCAGAACTTGAGGAGGTC (104.2% efficiency)

  • Aldh1l1: Forward GCAGGTACTTCTGGGTTGCT, Reverse GGAAGGCACCCAAGGTCAAA (90.67% efficiency)

This method has been shown to be superior to traditional approaches for astrocyte isolation and is recommended as a first-choice method for astrocyte isolation and characterization .

How can Atp1b2 be utilized as a biomarker in CNS injury and disease models?

Atp1b2 offers significant potential as a stable biomarker in CNS research for several reasons:

Stable Expression in Disease Models:
Unlike many other astrocyte markers that change expression levels during reactive astrogliosis, Atp1b2 has been shown to maintain stable expression across multiple models of CNS injury and disease . This stability makes it an ideal candidate for tracking astrocytes in various pathological conditions.

ACSA-2 Epitope Applications:
The identification of Atp1b2 as the ACSA-2 epitope enables:

• Consistent isolation of astrocytes from both healthy and diseased tissue

• Tracking of astrocyte populations during disease progression

• Comparison of astrocyte characteristics across different pathological states

• Development of imaging techniques for visualizing astrocytes in vivo

Methodological Recommendations:

• Use anti-Atp1b2 antibodies for immunohistochemical analysis of tissue sections from disease models

• Employ flow cytometry to quantify Atp1b2-positive cells in cell suspensions from affected tissues

• Isolate astrocytes using Atp1b2-based immunoaffinity methods for downstream molecular analysis

• Compare Atp1b2 expression with other astrocyte markers to identify subpopulations

Research indicates that the ACSA-2 antibody (targeting Atp1b2) "possesses the potential to be an extremely valuable tool for astrocyte research, allowing the purification and characterization of astrocytes (potentially including injury and disease models) without the need for any specialized and expensive equipment" .

What role might Atp1b2 play in cancer research based on recent findings?

Recent studies have expanded our understanding of Atp1b2's potential roles beyond its traditional function in ion transport, particularly in cancer biology:

Gastric Adenocarcinoma:
ATP1B2 (human homolog of rat Atp1b2) has been identified as a potential prognostic biomarker for gastric adenocarcinoma . Though the exact mechanisms are still being investigated, this suggests that Atp1b2 may play roles in:

• Cancer progression pathways

• Metastatic processes

• Tumor microenvironment modulation

• Potential therapeutic targeting

Research Implications:

• Examine Atp1b2 expression in various cancer cell lines and tumor tissues

• Investigate correlations between Atp1b2 levels and cancer progression/patient outcomes

• Explore the impact of Atp1b2 manipulation on cancer cell phenotypes

• Study potential interactions between Atp1b2 and known oncogenic pathways

Methodological Approaches:

• Use immunohistochemistry to assess Atp1b2 expression in tumor samples

• Perform survival analysis based on Atp1b2 expression levels

• Conduct functional studies with Atp1b2 knockdown or overexpression in cancer cells

• Explore potential interactions with the tumor microenvironment, particularly given Atp1b2's role in astrocytes

While research in this area is still emerging, the finding that ATP1B2 may serve as a prognostic biomarker for gastric adenocarcinoma opens new avenues for investigation into its potential roles in cancer biology.

How does Atp1b2's interaction with signaling pathways impact research applications?

Atp1b2's involvement in signaling pathways extends beyond its classical role in ion transport, with significant implications for research applications:

Retinoschisin Signaling:
Research has shown that retinoschisin (RS1) binds to the extracellular domain of Na/K-ATPase subunit β2 (Atp1b2) . This interaction has important consequences:

• Inhibition of Na/K-ATPase–associated signaling cascades

• Effects on Na/K-ATPase localization

• Formation of a retinoschisin-Na/K-ATPase complex that overlaps with signaling mediators

• Potential relevance to retinal dystrophy when disrupted

Research Applications:

• Investigate Atp1b2 as a receptor for extracellular signaling molecules

• Study how Atp1b2 interactions affect downstream signaling in astrocytes

• Explore therapeutic approaches targeting Atp1b2-mediated signaling in retinal diseases

• Examine how Atp1b2 glycosylation affects its ability to interact with signaling partners

Experimental Approaches:

• Use co-immunoprecipitation to identify Atp1b2 interaction partners

• Employ phosphorylation studies to track signaling pathway activation

• Develop fluorescent resonance energy transfer (FRET) assays to monitor protein-protein interactions

• Utilize domain-swapping experiments to identify critical interaction regions

Understanding these signaling interactions provides valuable insights into both normal physiology and pathological conditions, expanding the research applications of Atp1b2 beyond simple ion transport studies.