Somatostatin receptor type 5 (Sstr5) belongs to the family of G protein-coupled receptors that bind somatostatin, a peptide hormone initially isolated from hypothalamic tissue. Somatostatin acts through five receptor subtypes (SSTRs 1-5), each with distinct tissue distribution and functional roles. Among these subtypes, Sstr5 has emerged as a significant therapeutic target for various conditions, including neuroendocrine tumors, pituitary disorders, and metabolic abnormalities .
In rats, Sstr5 has been extensively studied as a model system for understanding the broader implications of somatostatin signaling in mammalian physiology. Recombinant rat Sstr5 provides researchers with valuable tools to investigate receptor-ligand interactions, signaling pathways, and potential therapeutic applications. The study of recombinant rat Sstr5 has contributed significantly to our understanding of somatostatin receptor biology and has implications for human health and disease management.
Rat Somatostatin receptor type 5 is encoded by the Sstr5 gene, which translates into a protein that functions as a receptor for somatostatin-28. The rat Sstr5 protein consists of a seven-transmembrane domain structure characteristic of G protein-coupled receptors. The activity of this receptor is mediated by G proteins that inhibit adenylyl cyclase, leading to various downstream signaling effects .
Recent structural studies using cryo-electron microscopy have provided detailed insights into the structural basis for activation of somatostatin receptor 5. These structures reveal that binding of peptide agonists causes rearrangement of a "hydrophobic lock" consisting of residues from transmembrane helices TM3 and TM6. This rearrangement triggers outward movement of TM6, enabling Gα i protein engagement and receptor activation .
The expression of Sstr5 in rats follows a specific developmental pattern. Studies investigating Sstr5 expression during rat embryonic development have provided valuable insights into its distribution and potential roles during different developmental stages.
For detection of Sstr5 mRNA, researchers have utilized RT-PCR techniques with specific primers. The forward primer sequence "CTGTCCTGCACAGAGACACG" and reverse primer sequence "CATTGGCGATGCTGAGC" have been employed to successfully amplify Sstr5 transcripts in rat tissues . Results are typically calculated by comparing the difference between crossing point values of the amplified sample and housekeeping genes using the formula 2-Δ (cpssts-cpTBP).
Interestingly, research has shown that there was no SSTR5 mRNA expression detected in whole rat embryos, despite the presence of SSTR5 protein observed at embryonal day 10. From day 11 to birth, SSTR5 protein presence increased over time in major structures such as skin and cartilage, while remaining relatively stable in the heart and liver .
| Embryonic Stage | mRNA Expression | Protein Expression | Tissue Localization |
|---|---|---|---|
| Day 10 | Not detected | Present | Various embryonic tissues |
| Days 11-birth | Not detected | Increasing | Skin, cartilage |
| Days 11-birth | Not detected | Stable | Heart, liver |
| Day 14 (Pancreas) | Not detected | Present | Co-localized with glucagon and pancreatic polypeptide cells |
In the developing pancreas, SSTR5 protein was found to co-localize primarily with glucagon and pancreatic polypeptide-producing cells, suggesting specific roles in regulating these hormones. This pattern differs from other somatostatin receptor subtypes, with SSTR1 co-localizing with multiple islet hormones, SSTR2 present in all islet endocrine cells except β-cells, and SSTR3-4 co-localizing with insulin and pancreatic polypeptide .
| Receptor Subtype | Insulin | Glucagon | Somatostatin | Pancreatic Polypeptide |
|---|---|---|---|---|
| SSTR1 | Yes | Yes | Yes | Yes |
| SSTR2 | No | Yes | Yes | Yes |
| SSTR3 | Yes | No | No | Yes |
| SSTR4 | Yes | No | No | Yes |
| SSTR5 | No | Yes | No | Yes |
In adult rats, Sstr5 is expressed in various tissues, with notable presence in pancreatic islets where it plays a key role in regulating insulin secretion. Subcellular localization studies indicate that Sstr5 is primarily found in the cell membrane , where it can respond to circulating somatostatin and mediate its effects on cellular function.
Sstr5 plays significant roles in various physiological processes, with particularly important functions in pancreatic islets and glucose homeostasis. Studies using Sstr5 knockout (Sstr5 KO) mice have provided valuable insights into these functions.
Sstr5 mediates the inhibitory effect of somatostatin on insulin secretion from pancreatic β-cells. Research has shown that mice deficient in Sstr5 displayed increased total insulin content in pancreatic islets compared to wild-type mice. Furthermore, Sstr5 KO mice exhibited decreased blood glucose and plasma insulin levels, along with increased leptin and glucagon concentrations .
| Parameter | Wild-Type Mice | Sstr5 KO Mice | Functional Implication |
|---|---|---|---|
| Pancreatic insulin content | Normal | Increased | Sstr5 normally limits insulin production |
| Blood glucose levels | Normal | Decreased | Sstr5 contributes to glucose homeostasis |
| Plasma insulin levels | Normal | Decreased | Complex role in insulin regulation |
| Leptin concentration | Normal | Increased | Possible role in adipose tissue function |
| Glucagon concentration | Normal | Increased | Involvement in α-cell regulation |
| Susceptibility to high-fat diet-induced insulin resistance | High | Decreased | Potential target for metabolic disorders |
The inhibitory effect of somatostatin-28 (SRIF-28) on glucose-stimulated insulin secretion was significantly reduced in islets from Sstr5 KO mice, with a 16-fold decrease in potency compared to wild-type islets. Additionally, Sstr5 KO mice showed decreased susceptibility to high-fat diet-induced insulin resistance, suggesting that Sstr5 contributes to the regulation of insulin sensitivity .
Beyond its role in metabolic regulation, Sstr5 also demonstrates interesting functional interactions with other somatostatin receptor subtypes. For example, Sstr5 can form heterodimers with Sstr2, which increases the cell growth inhibition activity of Sstr2 . This suggests that Sstr5 may have broader roles in regulating cell proliferation and potentially in tumor suppression.
Recombinant rat Sstr5 has become an invaluable tool for research into somatostatin signaling and receptor biology. Several commercial products and research tools are available to facilitate these investigations.
The Rat Somatostatin R5/SSTR5 (NP_037014) VersaClone cDNA contains the complete open reading frame (ORF) for Somatostatin R5/SSTR5, along with a Kozak consensus sequence for optimal translation initiation. This recombinant DNA construct is designed with convenient multiple cloning sites that facilitate easy transfer of the gene cassette into desired expression vectors. The sequence is verified, and the entire plasmid DNA and translated sequences are provided, ensuring reliability for research applications .
Research using recombinant rat Sstr5 has yielded significant insights into receptor activation mechanisms, ligand selectivity, and potential therapeutic applications.
Recent structural studies have revealed distinct binding modes and conformational changes induced by different cyclic peptide agonists, namely cortistatin-17 (CST17) and octreotide. These structures show how extracellular loops differently recognize these ligands, and how a "hydrophobic lock" mediates ligand-specific interactions and receptor activation. The insights gained from these studies provide valuable guidance for structure-based drug development targeting Sstr5 for therapeutic purposes .
| Ligand | Binding Mode | Key Interactions | Conformational Changes | Functional Outcome |
|---|---|---|---|---|
| Cortistatin-17 (CST17) | Disulfide-stabilized β hairpin structure | Extensive polar and hydrophobic interactions | Rearrangement of hydrophobic lock, outward movement of TM6 | Full receptor activation |
| Octreotide | Upright binding in orthosteric pocket | Conserved F DWKT motif forms hydrophobic interactions | Similar to CST17 but with distinct ECL interactions | Activation with different potency/efficacy |
| Somatostatin-28 | Similar to natural ligand | Multiple contact points | Standard activation mechanism | Physiological inhibition of cellular processes |
Functional studies using Sstr5 knockout models have demonstrated the receptor's importance in glucose homeostasis and insulin regulation. These findings suggest potential beneficial roles for Sstr5 antagonists in alleviating metabolic abnormalities associated with obesity and insulin resistance . Given the increasing prevalence of metabolic disorders worldwide, this research direction holds significant clinical relevance.
Developmental studies have mapped the expression patterns of Sstr5 throughout rat embryogenesis, providing insights into its potential roles in tissue development and differentiation. The distinct co-localization patterns with different pancreatic hormones suggest specific regulatory functions in endocrine cell development and function .
STRING: 10116.ENSRNOP00000025451
UniGene: Rn.91342
SSTR5 is a G protein-coupled receptor that functions as a receptor for somatostatin-28. Its activity is mediated by G proteins, particularly Gαi, which inhibit adenylyl cyclase . In rat models, SSTR5 plays a crucial role in various physiological processes, including hormone regulation and cell growth inhibition. It forms heterodimers with SSTR2, which increases the cell growth inhibition activity of SSTR2 . SSTR5 is primarily located in the cell membrane and is involved in mediating the inhibitory effects of somatostatin on various cellular functions.
In rat embryonic development, SSTR5 protein has been observed as early as embryonal day 10, though interestingly, some studies have not detected SSTR5 mRNA expression in whole rat embryos while still detecting the protein . This suggests complex post-transcriptional regulatory mechanisms that warrant further investigation.
Among the five somatostatin receptor subtypes (SSTR1-5), SSTR5 shows distinct characteristics:
Binding Preferences: SSTR5 has higher affinity for somatostatin-28 compared to somatostatin-14, unlike other subtypes.
Structural Uniqueness: Recent cryo-EM structures reveal that SSTR5 has distinct conformational changes upon binding to cyclic peptide agonists like cortistatin-17 (CST17) and octreotide .
Developmental Expression: While other receptor subtypes like SSTR1-2 and SSTR4 show peak mRNA expression at day 14 in rat embryonic development, and SSTR3 appears at day 15, the expression profile of SSTR5 differs significantly .
Functional Role: SSTR5 specifically mediates the inhibition of peptide YY secretion in response to somatostatin-28 stimulation, a function not shared by other subtypes .
Co-localization Patterns: In pancreatic islets, SSTR5 primarily co-localizes with glucagon and pancreatic polypeptide-producing cells, while other subtypes show different cellular associations. For example, SSTR2 is present in all islet endocrine cells except β-cells, and SSTR3-4 co-localize with insulin and pancreatic polypeptide .
The developmental expression of SSTR5 in rats follows a complex pattern:
Protein Expression: SSTR5 protein has been detected as early as embryonal day 10 .
Tissue Distribution: From embryonal day 11 to birth, SSTR5 protein presence increases progressively in major structures such as skin and cartilage, while remaining relatively stable in tissues like heart and liver .
Pancreatic Expression: In the fetal pancreas, SSTR5 protein shows specific co-localization with glucagon and pancreatic polypeptide-producing cells .
mRNA Expression Peculiarity: Interestingly, some studies have reported no detectable SSTR5 mRNA expression in whole rat embryos despite observing the protein . This discrepancy suggests possible post-transcriptional regulatory mechanisms or technical limitations in mRNA detection methods.
Recent cryo-EM studies have revealed the molecular mechanisms of SSTR5 activation:
High-Resolution Structures: Cryo-EM structures of SSTR5-Gi complexes bound to cortistatin-17 (CST17) and octreotide have been determined at 2.7 Å and 2.9 Å resolutions, respectively .
Hydrophobic Lock Mechanism: Both CST17 and octreotide trigger the rearrangement of a "hydrophobic lock" consisting of residues from transmembrane helices TM3 and TM6. This rearrangement causes an outward movement of TM6, enabling Gαi protein engagement and receptor activation .
Distinct Binding Modes: Despite sharing a conserved F(L/D)WKT motif, CST17 and octreotide exhibit different interaction modes with SSTR5 due to variations in disulfide bond positions .
Key Structural Differences:
Role of Extracellular Loops: The extracellular loops of SSTR5 respond differently to CST17 and octreotide, contributing to ligand selectivity. Mutations like N187^45.51T or T185^ECL2W in SSTR5 (which mimic SSTR2's ECL2 residues) significantly enhance octreotide's efficacy in activating SSTR5 .
SSTR5 shows both conserved and distinctive features in its activation mechanism compared to other Class A GPCRs:
Conserved Features: Like other class A GPCRs, activated SSTR5 exhibits:
Distinctive Features: SSTR5 shows subtle deviations from established Class A GPCR activation mechanisms:
Ligand-Specific Activation: Different agonists (CST17 vs. octreotide) induce subtle conformational differences (RMSD values of 1.43 Å for the receptor and 1.50 Å across entire complexes), highlighting the plasticity in SSTR5 activation mechanisms .
Several key molecular features determine agonist selectivity for SSTR5:
Extracellular Loop Configuration: The extracellular loops of SSTR5 play a crucial role in specific recognition of different agonists. For example, ECL2 is particularly important for octreotide selectivity .
Polar Interaction Networks: A polar network formed by Q99^2.63, T185^ECL2, and N187^45.51 appears to influence octreotide binding and may actually hinder activation of SSTR5 by octreotide relative to other receptor subtypes .
Key Residue Differences: Mutations that transform SSTR5 residues to match those in SSTR2 (such as N187^45.51T or T185^ECL2W) enhance octreotide efficacy, highlighting the importance of these residues in determining subtype selectivity .
Ligand Structure Variations: The positioning of disulfide bonds within peptide ligands creates structural variations that lead to different interaction modes with the receptor subtypes. This is evident in the distinct binding conformations of CST17 and octreotide within SSTR5 .
Several complementary methods are recommended for comprehensive assessment of SSTR5 expression:
RT-PCR for mRNA Detection:
ELISA for Protein Quantification:
Immunohistochemistry for Localization:
Single-Point Mutation Analysis:
A comprehensive experimental approach should include:
Receptor Activation Studies:
Protein-Protein Interaction Studies:
Mutagenesis Approaches:
Developmental Expression Studies:
Controls and Validation:
Include appropriate pharmacological controls (antagonists like pasireotide)
Validate findings with multiple methodologies to address potential technique-specific limitations
When working with recombinant rat SSTR5:
Expression System Selection:
Receptor Stabilization:
Ligand Selection:
Functional Validation:
Verify that recombinant SSTR5 maintains appropriate:
Ligand binding affinity
G protein coupling
Signaling properties
Response to known agonists/antagonists
Structural Analysis Considerations:
When faced with contradictory data such as the discrepancy between SSTR5 mRNA and protein detection in embryonic studies:
Technical Validation:
Employ multiple primer sets for RT-PCR to rule out technical limitations
Verify antibody specificity through knockout controls or competing peptides
Use multiple detection methods (in situ hybridization, RT-PCR, immunohistochemistry, Western blot)
Tissue-Specific Analysis:
Whole embryo preparations may dilute tissue-specific signals
Consider microdissection to isolate specific tissues of interest
Perform single-cell RNA sequencing to detect cell-specific expression patterns
Developmental Timeline Considerations:
Increase sampling frequency during critical developmental windows
Consider potential transient expression patterns that might be missed with limited timepoints
Post-Transcriptional Regulation Assessment:
Investigate microRNA regulation of SSTR5 mRNA
Assess mRNA stability through actinomycin D chase experiments
Examine potential alternative splicing events
Data Integration Framework:
Create a comprehensive table comparing results across methodologies and developmental timepoints
Weight evidence based on methodological strengths and limitations
Consider biological explanations for apparent contradictions
Based on recent structural and functional insights:
Structure-Guided Design:
Extracellular Loop Targeting:
Biased Agonism Exploration:
Design ligands that selectively activate specific downstream pathways
Study the distinct conformational states induced by different ligands to understand the structural basis of biased signaling
Heterodimer-Specific Approaches:
Several genetic approaches offer promising avenues for SSTR5 research:
Conditional Knockout Models:
Generate tissue-specific and inducible SSTR5 knockout rat models
Study the temporal and spatial requirements for SSTR5 in development and disease
Assess compensatory mechanisms involving other somatostatin receptor subtypes
Knock-in Models with Reporter Tags:
Create knock-in models expressing SSTR5 fused to fluorescent proteins or epitope tags
Enable real-time visualization of receptor trafficking and localization
Facilitate isolation of SSTR5-expressing cells for transcriptomic and proteomic analysis
CRISPR-Based Approaches:
Introduce specific mutations identified in structural studies to validate their functional significance in vivo
Create models expressing humanized SSTR5 for better translational relevance
Generate models with mutations that affect heterodimer formation to study SSTR5-SSTR2 interactions
Disease Models:
Introduce SSTR5 mutations or expression changes associated with human diseases
Study the role of SSTR5 in models of neuroendocrine tumors, pituitary disorders, and pancreatic dysfunction
Evaluate potential therapeutic interventions targeting SSTR5