Recombinant Saccharomyces cerevisiae Protein YLR162W (YLR162W)

What is YLR162W and where is it located in the S. cerevisiae genome?

YLR162W is an uncharacterized Saccharomyces cerevisiae ORF located approximately 20 kb upstream of the chromosomal rDNA repeat in chromosome XII. It is believed to have originated from a duplication event, as its third half and attached flanking region (about 1 kb) shares more than 99% similarity to the reverse complement of the 25S rRNA coding region . The gene encodes a hypothetical membrane protein with a molecular mass of 13,055 Da (NCBI accession no. 568478) consisting of 118 amino acids . Understanding its genomic context is crucial for researchers investigating its evolutionary origin and potential functional relationships with nearby genes.

What are the structural characteristics of the YLR162W protein?

The YLR162W protein contains 118 amino acids with one putative transmembrane domain coded by residues 37-53 . It has been classified as a type-2 membrane protein that lacks a cleavable signal sequence and displays an N-terminal extracellular and C-terminal cytoplasmic orientation . This structural arrangement suggests that the protein may function in cellular membrane processes, potentially in signaling or transport. Researchers investigating the protein should consider these structural features when designing experiments to probe its functionality, particularly when creating tagged versions for localization or interaction studies.

How can researchers differentiate between YLR162W and similar sequences in the S. cerevisiae genome?

Since YLR162W shares significant sequence similarity with the 25S rRNA coding region, researchers must employ specific strategies to ensure targeted analysis. When designing PCR primers for YLR162W amplification, researchers should select sequences unique to the coding region, avoiding the similar rRNA regions. Northern blotting experiments should use single-stranded probes prepared by primer extension with antisense primers specific to YLR162W, as demonstrated in the literature where researchers used the primer sequence 5′ GGATCCGAATTCCTA GCAACGGGTGCTCTTGGCGGAAAGGCC 3′ . Additionally, sequence verification following cloning is essential to confirm the identity of YLR162W versus similar sequences.

Under what conditions is YLR162W expression upregulated or downregulated?

YLR162W shows distinct expression patterns under various conditions, which provides clues to its physiological role. The transcript level is significantly elevated during:

• Environmental stress conditions

• Response to α-factor (increased by approximately 50-fold)

• Stationary phase growth

• High-pressure stress

• Magnesium starvation

• Conditions of elevated spontaneous mutation rate and genomic instability (cells overexpressing MLH1)

Conversely, YLR162W expression is reduced during:

• Oxidative and reductive stress

• Hypoxic conditions

• Hypoxia followed by reoxygenation in both glucose and galactose media

These expression patterns suggest that YLR162W may be part of a cellular stress response mechanism that helps cells adapt to adverse environmental conditions, potentially by inhibiting cell proliferation to conserve energy resources.

What are the most reliable methods for monitoring YLR162W expression in experimental systems?

Based on established research protocols, the following methods have proven effective for monitoring YLR162W expression:

• Northern blotting: Using 32P-labeled single-stranded probes prepared by primer extension with the YLR162W antisense primer . This approach allows for specific detection of YLR162W transcripts even in the presence of similar sequences.

• Western blotting: For protein-level detection, cell lysis followed by immunoblotting with antibodies specific to YLR162W or to epitope tags fused to the protein .

• RT-qPCR: Real-time quantitative PCR using primers specific to unique regions of YLR162W can provide sensitive quantification of transcript levels.

To ensure reliable results, researchers should include appropriate controls in their experiments, such as reference genes for normalization in qPCR (e.g., ACT1 or TUB1) and positive/negative controls for Western blotting.

How does cobalt chloride (CoCl₂) treatment affect YLR162W expression and what implications does this have for hypoxia research?

Northern blotting experiments have demonstrated that YLR162W transcript levels are reduced in BY4741 cells during exposure to CoCl₂, a well-established hypoxia mimetic agent in S. cerevisiae and mammalian cell cultures . This reduction in YLR162W expression during hypoxic conditions suggests that the gene may be involved in oxygen-sensing or oxygen-dependent metabolic pathways.

Interestingly, while YLR162W expression decreases under hypoxic conditions, continuous expression of YLR162W from a plasmid-borne copy renders cells extremely susceptible to hypoxic conditions induced by CoCl₂ . This apparent contradiction suggests a complex regulatory relationship between YLR162W and hypoxic response mechanisms, where the normal response to hypoxia includes downregulation of YLR162W, likely as a protective mechanism.

For researchers studying hypoxia response in yeast, YLR162W could serve as a marker for hypoxic conditions. Additionally, the increased sensitivity to CoCl₂ in cells overexpressing YLR162W suggests that this protein could be targeted in studies seeking to enhance the effects of hypoxia-targeted treatments.

What is known about the cellular effects of YLR162W overexpression?

Overexpression of YLR162W in S. cerevisiae results in several significant phenotypic changes:

• Growth inhibition: Continuous expression of YLR162W has a slight inhibitory effect on cell proliferation under normal conditions .

• Hypoxia sensitivity: YLR162W overexpression renders cells extremely sensitive to chronic CoCl₂ exposure, suggesting increased susceptibility to hypoxic conditions .

• Cell cycle arrest: Following the removal of α-factor block, cells expressing YLR162W enter S phase but do not progress to G2 phase. Instead, sub-G1 and G1 peaks re-emerge, indicating cell cycle inhibition .

• Apoptosis induction: The emergence of a distinct sub-G1 peak and increased propidium iodide permeability indicates that YLR162W expression induces apoptosis in BY4741 cells .

• Mitochondrial membrane potential reduction: Mitochondrial membrane potential begins decreasing within 30 minutes of YLR162W expression induction and continues to decrease further, consistent with the initiation of apoptosis .

These effects suggest that YLR162W plays a role in stress response pathways, potentially acting as a growth inhibitor during unfavorable conditions to conserve cellular resources.

How does YLR162W influence cell cycle progression and apoptosis?

YLR162W overexpression disrupts normal cell cycle progression in a specific manner. Flow cytometry data reveals that following α-factor synchronization and release, cells expressing YLR162W initially enter S phase (15-30 minutes post-release) but fail to progress to G2 phase. Instead, sub-G1 and G1 peaks re-emerge (45 minutes onwards), indicating cell cycle arrest and the onset of apoptosis .

The sub-G1 peak is a classic indicator of apoptotic cells, suggesting DNA fragmentation. This apoptotic effect is further confirmed by:

• Increased propidium iodide permeability: Flow cytometry data shows that YLR162W overexpression causes an increase in the number of cells permeable to propidium iodide, indicating cell death .

• Decreased mitochondrial membrane potential (ψm): ψm begins decreasing within 30 minutes of YLR162W expression induction, a characteristic early event in the apoptotic pathway .

Interestingly, the absence of key checkpoint proteins (Chk1, Rad9, Dun1) cannot overcome the inhibitory effect of YLR162W, suggesting that the apoptotic pathway induced by YLR162W may be independent of these checkpoint functions . This indicates that YLR162W might be activating alternative apoptotic pathways in yeast, providing a valuable model for studying checkpoint-independent apoptosis mechanisms.

What is the relationship between YLR162W and antimicrobial resistance?

Expression studies have shown that YLR162W overexpression provides resistance against an anti-microbial peptide (MiAMP1) in a strain of S. cerevisiae that is susceptible to this peptide . This finding suggests that YLR162W may play a role in the cell's defense mechanisms against certain antimicrobial compounds.

The relationship between YLR162W and antimicrobial resistance presents an intriguing contrast to its growth-inhibitory properties. This dual nature suggests that the protein may serve different functions depending on the specific stress condition. Under antimicrobial stress, YLR162W may enhance survival by contributing to resistance mechanisms, while under other stress conditions, it may promote growth inhibition to conserve resources.

For researchers investigating antimicrobial resistance mechanisms, this presents several experimental avenues:

• Comparative studies of YLR162W expression in resistant versus susceptible strains when exposed to various antimicrobial compounds

• Investigation of potential interactions between YLR162W and known antimicrobial resistance pathways

• Exploration of whether YLR162W-mediated resistance is specific to MiAMP1 or extends to other antimicrobial agents

Understanding this relationship could contribute to the development of strategies to overcome antimicrobial resistance or to enhance the efficacy of antimicrobial compounds.

What are the recommended methods for cloning and expressing YLR162W in experimental systems?

Based on established research protocols, the following methods are recommended for cloning and expressing YLR162W:

Cloning Strategy:

• PCR amplification of YLR162W using specific primers that avoid regions with similarity to rRNA genes. Reported primers include YLR162WS: 5′ ATCGATAAGCTT ATATGCAGCACGCTTACCCGGACCGCCTCT 3′ and YLR162W AS: 5′ GGATCCGAATTCCTA GCAACGGGTGCTCTTGGCGGAAAGGCC 3′ .

• Digestion of the PCR product and vector with appropriate restriction enzymes. Previous studies have used BamHI and HindIII for confirmation of recombinant plasmids .

• Ligation of the YLR162W fragment into an appropriate expression vector. For inducible expression in yeast, vectors with GAL1 promoters have been successfully used .

Expression Systems:

• For controlled expression in S. cerevisiae, galactose-inducible systems have proven effective, allowing for the study of YLR162W effects at specific timepoints after induction .

• For protein production and purification, E. coli expression systems can be used with appropriate fusion tags (His, GST, etc.) to facilitate purification.

The expression of YLR162W should be verified by Western blotting using antibodies against the protein or against epitope tags fused to the protein . Researchers should note that continuous expression of YLR162W has growth-inhibitory effects, which may necessitate the use of tightly regulated inducible systems.

How can researchers effectively measure the effects of YLR162W on cell survival and mitochondrial function?

To measure the effects of YLR162W on cell survival and mitochondrial function, researchers can employ the following methodologies:

Cell Survival Assays:

• Spot assay: Perform serial dilutions (10³, 10², 10¹, 10⁰ cells) of log-phase cells and spot onto plates containing appropriate media with or without stressors (e.g., CoCl₂). Incubate at 30°C for three days before imaging to assess viability .

• Propidium iodide (PI) staining: To quantify cell death, wash cells with PBS, suspend in 500 μl PBS, add 15 μl of 1 mg/ml PI solution, incubate at 30°C for 30 minutes, and analyze by flow cytometry. PI-positive cells indicate cell death .

• Flow cytometry analysis of cell cycle: Synchronize cells with α-factor, induce YLR162W expression, and analyze DNA content by flow cytometry to detect sub-G1 peaks indicative of apoptotic cells .

Mitochondrial Function Assessment:

• Mitochondrial membrane potential (ψm) measurement: Harvest cells at different time intervals after YLR162W induction, wash with ice-cold water, suspend at 10⁶ cells/ml, add Rhodamine123 (Rh123) to a final concentration of 25 nM, incubate for 10 minutes at 30°C in the dark, and analyze by flow cytometry . Use cells treated with 20 mM NaN₃ as a control for decreased ψm.

• ROS detection assays: Use fluorescent probes like dihydroethidium (DHE) or 2',7'-dichlorodihydrofluorescein diacetate (H₂DCFDA) to measure reactive oxygen species production, which often accompanies mitochondrial dysfunction.

These methodologies provide complementary data on the cellular effects of YLR162W, allowing researchers to characterize its role in cell survival, apoptosis, and mitochondrial function.

What experimental design would best address the contradiction between YLR162W upregulation during stress and its growth-inhibitory properties?

The apparent contradiction between YLR162W upregulation during stress conditions and its growth-inhibitory properties when overexpressed presents an intriguing research question. To address this contradiction, the following experimental design is recommended:

1. Temporal expression analysis:

• Monitor YLR162W expression levels at different time points during various stress responses using qRT-PCR or Northern blotting

• Correlate expression levels with growth rate, cell cycle progression, and viability

• Hypothesis: YLR162W may show transient upregulation during the initial stress response, followed by downregulation during adaptation

2. Dose-dependent effects study:

• Create a series of strains with varying levels of YLR162W expression (using promoters of different strengths)

• Measure growth rates, cell cycle progression, and stress resistance in each strain

• Hypothesis: Moderate increases in YLR162W expression might enhance stress resistance, while high levels may inhibit growth

3. Conditional knockout and complementation experiments:

• Generate a YLR162W knockout strain and characterize its phenotype under various stress conditions

• Complement the knockout with wild-type or mutant YLR162W under native or inducible promoters

• Hypothesis: Loss of YLR162W might impair stress resistance but enhance growth under certain conditions

4. Interactome analysis:

• Identify protein-protein interactions of YLR162W using techniques such as yeast two-hybrid, co-immunoprecipitation, or proximity labeling

• Map interactions under normal and stress conditions

• Hypothesis: YLR162W may interact with different partners under different conditions, explaining its context-dependent functions

5. Subcellular localization studies:

• Track the localization of YLR162W-GFP fusion protein under normal and stress conditions

• Monitor changes in localization over time during stress response and recovery

• Hypothesis: YLR162W may relocalize within the cell during stress, affecting its function

This comprehensive experimental approach would help elucidate whether YLR162W's contradictory properties are due to concentration-dependent effects, temporal regulation, context-specific interactions, or changes in subcellular localization. The design addresses both the basic characterization of YLR162W function and the more advanced question of how seemingly contradictory properties contribute to cellular stress responses.

What are the potential applications of YLR162W in biotechnology and pharmaceutical research?

The unique properties of YLR162W suggest several potential applications in biotechnology and pharmaceutical research:

• Anticancer drug development: The ability of YLR162W to induce apoptosis and inhibit cell cycle progression, particularly in hypoxic conditions, makes it a potential model for developing anticancer agents targeting hypoxic tumor cells . Hypoxia is a common feature of solid tumors and contributes to cancer progression and treatment resistance.

• Antimicrobial peptide research: YLR162W's role in providing resistance against the antimicrobial peptide MiAMP1 suggests it could be studied to understand mechanisms of antimicrobial resistance and to develop strategies to enhance antimicrobial efficacy .

• Stress response modulation: As part of the cellular stress response mechanism, YLR162W could serve as a target for modulating cellular responses to various stresses, with applications in improving industrial yeast strains' tolerance to process conditions.

• Cell growth control systems: The growth-inhibitory properties of YLR162W could be harnessed to create inducible growth control systems in biotechnology applications, allowing precise regulation of cell proliferation in bioproduction processes.

• Peptide-based pharmaceutical agents: As noted in research, "the hitherto uncharacterized S. cerevisiae ORF YLR162W or peptides synthesized based upon Ylr162wp may be important pharmaceutical agents for its growth inhibitory properties especially during exposure to hypoxic conditions" . This suggests the development of peptide mimetics based on YLR162W structure for therapeutic applications.

Future research should focus on elucidating the precise molecular mechanisms by which YLR162W exerts its effects, which would facilitate the rational design of applications leveraging these properties.

What are the key unanswered questions about YLR162W that warrant further investigation?

Despite the progress in understanding YLR162W, several critical questions remain unanswered and warrant further investigation:

• Molecular mechanism of action: How does YLR162W induce apoptosis and cell cycle arrest at the molecular level? Which signaling pathways are activated or inhibited?

• Protein interactions: What are the binding partners of YLR162W under normal and stress conditions? Does it function alone or as part of a complex?

• Structure-function relationship: Which domains or amino acid residues of YLR162W are critical for its various functions, including membrane localization, growth inhibition, and antimicrobial resistance?

• Evolutionary conservation: Are there functional homologs of YLR162W in other organisms, including pathogenic fungi and higher eukaryotes? How conserved are its functions?

• Regulation mechanisms: What transcription factors and signaling pathways regulate YLR162W expression under various conditions? How is its protein stability and localization controlled?

• Physiological role: What is the native function of YLR162W in yeast cells? Is it primarily a stress response protein, and if so, what specific stresses does it help the cell adapt to?

• Connection to rDNA: Given its genomic location near rDNA and sequence similarity to rRNA, does YLR162W play any role in ribosome biogenesis or function?

• Post-translational modifications: Is YLR162W subject to phosphorylation, ubiquitination, or other modifications that regulate its activity?

• Membrane interactions: As a putative membrane protein, how does YLR162W interact with membrane components, and does it affect membrane integrity or transport functions?

Addressing these questions would significantly advance our understanding of YLR162W and potentially reveal new insights into stress response mechanisms, apoptosis regulation, and membrane protein functions in eukaryotes.

How can researchers integrate YLR162W studies with emerging technologies in functional genomics?

Integrating YLR162W studies with emerging technologies in functional genomics offers exciting opportunities for comprehensive characterization of this protein. Researchers should consider the following approaches:

• CRISPR-Cas9 genome editing:

  • Generate precise modifications to YLR162W, including point mutations, domain deletions, and regulatory element alterations

  • Create endogenous tags for visualization and purification without overexpression artifacts

  • Perform genome-wide CRISPR screens to identify genetic interactions with YLR162W

• Single-cell technologies:

  • Apply single-cell RNA-seq to capture heterogeneity in YLR162W expression and cellular responses

  • Use single-cell proteomics to correlate YLR162W protein levels with phenotypic outcomes

  • Employ microfluidics-based approaches to track individual cell fates following YLR162W induction

• Advanced imaging techniques:

  • Implement super-resolution microscopy to precisely localize YLR162W within membrane microdomains

  • Use live-cell imaging with optogenetic tools to activate YLR162W expression with spatiotemporal precision

  • Apply correlative light and electron microscopy to link YLR162W localization with ultrastructural changes

• Multi-omics integration:

  • Combine transcriptomics, proteomics, metabolomics, and lipidomics data to build comprehensive models of YLR162W function

  • Use network analysis to position YLR162W within cellular signaling pathways

  • Implement machine learning approaches to predict conditions where YLR162W plays critical roles

• Structural biology approaches:

  • Utilize cryo-electron microscopy to determine the structure of YLR162W in its membrane environment

  • Apply cross-linking mass spectrometry to identify interaction interfaces

  • Use computational modeling and molecular dynamics simulations to predict functional domains and conformational changes

• Synthetic biology tools:

  • Develop synthetic circuits incorporating YLR162W to create tunable stress response systems

  • Design reporter systems to monitor YLR162W activity in real-time

  • Create orthogonal systems to test YLR162W function in heterologous contexts

By integrating these advanced techniques, researchers can develop a systems-level understanding of YLR162W function, regulation, and potential applications, advancing both basic science knowledge and applied biotechnological innovations.