Recombinant Schizosaccharomyces pombe Putative uncharacterized membrane protein C622.06c (SPCC622.06c)

What is SPCC622.06c and why is it classified as a "hypothetical protein"?

SPCC622.06c is a protein-coding gene in Schizosaccharomyces pombe (fission yeast) with Entrez Gene ID 2539282. It is classified as "hypothetical" because while genomic sequencing has identified its open reading frame, the protein product has not been experimentally confirmed or functionally characterized. According to genomic databases, SPCC622.06c has an mRNA accession number of NM_001023168.2 and a protein accession of NP_588178.1 . The ORF nucleotide sequence is 369bp in length, which translates to a protein of approximately 123 amino acids. The "hypothetical" classification indicates that while bioinformatic analysis predicts this gene encodes a protein, direct experimental evidence concerning its expression, cellular location, and function remains limited.

What are the structural features of SPCC622.06c predicted from sequence analysis?

The SPCC622.06c gene encodes a putative membrane protein with several predicted structural features:

Sequence analysis suggests SPCC622.06c contains hydrophobic regions consistent with transmembrane domains, though the exact topology requires experimental verification . The protein sequence begins with "ATGAGCCCAAAGGAATCCATCGAGTTGCAAGAATTCCAGTCGCTGCTTCAGGACGAAGCA" as indicated in the cDNA clone information, consistent with a standard methionine start codon . Researchers should employ multiple prediction algorithms to build confidence in structural models before proceeding with experimental characterization.

How is SPCC622.06c genomically organized in S. pombe?

The genomic designation "SPCC622.06c" follows the standard S. pombe nomenclature where:

• "SP" denotes Schizosaccharomyces pombe

• "C" indicates chromosome III location

• "622" identifies the cosmid number

• "06" indicates it is the sixth gene on this cosmid

• "c" signifies it is encoded on the complementary (reverse) strand

The gene is located in a genomic region documented in the complete S. pombe genome sequence published in Nature . The gene structure appears to be relatively simple, with the sequence categorized as "PROVISIONAL REFSEQ" in genomic databases, indicating it was derived from an annotated genomic sequence (NC_003421) . The annotation history shows the current sequence version replaced a previous version (NM_001023168.1) on December 10, 2012, suggesting refinements to the genome annotation have occurred over time.

What expression systems are optimal for recombinant SPCC622.06c production?

For recombinant expression of SPCC622.06c, researchers should consider multiple expression systems based on experimental objectives:

The optimal approach depends on research objectives. For functional studies, homologous expression maintains the native context, while heterologous systems may be preferable for structural studies requiring higher protein yields.

How can I generate a stable S. pombe strain expressing tagged SPCC622.06c?

Recent advances in S. pombe molecular tools offer improved methods for generating stable expression strains. The following methodological approach is recommended:

• Select an appropriate vector system: Utilize the stable integration vectors (SIVs) described by researchers that target different prototrophy genes . These vectors produce non-repetitive genomic loci and integrate predominantly as single copies, addressing instability issues observed with older vector systems.

• Design your construct: Clone SPCC622.06c into your selected SIV with your tag of choice (fluorescent protein, epitope tag). The modular toolbox described in research literature includes various options for antibiotic resistance markers, promoters, fluorescent tags, and terminators .

• Transform and select transformants: Following standard S. pombe transformation protocols, select transformants using appropriate markers (prototrophy or antibiotic resistance).

• Verify expression and stability: Confirm correct integration by PCR and sequencing. Verify protein expression by Western blotting or microscopy (for fluorescent tags). Assess strain stability through multiple generations.

• Functional validation: Compare phenotypes between wild-type and tagged strains to ensure tag addition doesn't disrupt protein function.

The complementary auxotrophic alleles developed alongside these vectors help prevent false-positive integration events, increasing confidence in your resultant strains .

What purification strategies work best for membrane proteins like SPCC622.06c?

Purifying putative membrane proteins requires specialized approaches to maintain native structure and function:

• Membrane preparation: Optimize cell lysis conditions and membrane fraction isolation to ensure enrichment of SPCC622.06c.

• Detergent screening: Test multiple detergents at various concentrations to identify optimal solubilization conditions. Begin with mild detergents (DDM, LMNG) before trying more stringent options.

• Affinity purification: If using tagged protein (the commercial clone has a C-terminal DYKDDDDK tag ), employ affinity chromatography as an initial purification step.

• Size exclusion chromatography: Use as a final polishing step to separate protein-detergent complexes from aggregates or impurities.

• Alternative solubilization approaches: For structural studies, consider nanodiscs, amphipols, or SMALPs (styrene maleic acid lipid particles) which can extract membrane proteins with their native lipid environment.

Perform stability assays throughout purification to ensure the protein remains folded and functional. Small-scale optimization is crucial before scaling up to larger preparations.

What experimental approaches determine the cellular localization of SPCC622.06c?

To determine the subcellular localization of SPCC622.06c, employ multiple complementary approaches:

• Fluorescent protein tagging: Utilize the stable integration vectors with fluorescent tags available for S. pombe . Create C-terminal or N-terminal fusions (considering potential interference with signal sequences) for visualization in living cells.

• Immunofluorescence microscopy: If antibodies against SPCC622.06c or an epitope tag are available, perform immunofluorescence on fixed cells using standard protocols established for S. pombe.

• Co-localization analysis: The ready-to-use fluorescent probes marking organelles and cellular processes in fission yeast provide excellent controls for co-localization studies to define precise subcellular compartments.

• Subcellular fractionation: Separate cellular components through differential centrifugation followed by Western blotting to detect SPCC622.06c in specific fractions.

• Electron microscopy: For higher resolution localization, use immunogold labeling with transmission electron microscopy.

Combining these approaches provides robust evidence for localization while minimizing artifacts from any single method. Pay particular attention to membrane compartment markers, as SPCC622.06c is predicted to be membrane-associated.

How can I determine if SPCC622.06c interacts with other proteins?

To identify protein interaction partners of SPCC622.06c, consider these methodological approaches:

• Affinity purification coupled with mass spectrometry (AP-MS): Express tagged SPCC622.06c, perform gentle solubilization to preserve interactions, and identify co-purified proteins by mass spectrometry. This approach has been successfully applied to membrane proteins like Sec62 .

• Proximity labeling methods: Fuse SPCC622.06c to enzymes like BioID or APEX2 that biotinylate proximal proteins, allowing subsequent purification and identification of the labeled proteome.

• Co-immunoprecipitation: Use antibodies against tagged SPCC622.06c for targeted verification of suspected interactions. This technique successfully demonstrated interaction between Sec62 and LC3 in autophagy research .

• Yeast two-hybrid adaptations: Consider membrane yeast two-hybrid systems specifically designed for membrane proteins.

• Fluorescence-based interaction assays: For candidate interactions, employ FRET, BiFC, or split-luciferase assays in living cells.

When analyzing results, differentiate between direct binding partners and proteins present in the same complex or compartment. Sec62 research demonstrates how interaction studies can reveal functional connections to cellular processes like autophagy .

What computational approaches can predict the function of uncharacterized proteins like SPCC622.06c?

Computational prediction for uncharacterized proteins should employ multiple complementary approaches:

• Sequence-based methods:

  • PSI-BLAST and HHpred for detecting remote homologs

  • Motif/domain searches using Pfam, PROSITE databases

  • Transmembrane topology prediction (TMHMM, Phobius)

  • Signal peptide prediction (SignalP)

• Structure-based methods:

  • Protein structure prediction (AlphaFold2, RoseTTAFold)

  • Structural comparison with functionally characterized proteins

  • Binding site and active site prediction

• Genomic context analysis:

  • Gene neighborhood examination across species

  • Co-expression patterns with genes of known function

  • Analysis of cell-cycle regulation patterns

• Evolutionary analysis:

  • Conservation patterns in specific regions

  • Selection pressure analysis (dN/dS ratios)

  • Presence/absence patterns across related species

The results from these analyses should be integrated to develop testable hypotheses about SPCC622.06c function, particularly examining whether it follows expression patterns similar to cell cycle-regulated genes in S. pombe .

How should I design experiments to test the potential role of SPCC622.06c in membrane processes?

A systematic experimental approach to elucidate SPCC622.06c function should include:

• Gene deletion analysis:

  • Generate SPCC622.06c knockout strain

  • Perform comprehensive phenotypic characterization under various growth conditions

  • Analyze membrane integrity, organization, and function

• Regulated expression studies:

  • Create strains with SPCC622.06c under inducible promoters for controlled expression

  • Analyze effects of overexpression and depletion

  • Monitor cellular responses to membrane stress during expression changes

• Genetic interaction mapping:

  • Perform systematic genetic interaction screens (e.g., synthetic genetic arrays)

  • Create double mutants with genes involved in known membrane processes

  • Analyze epistatic relationships with genes like those in the TSC pathway

• Response to membrane perturbations:

  • Test sensitivity to compounds affecting membrane integrity

  • Examine response to osmotic shock, temperature shifts

  • Analyze ER stress response pathways, similar to studies conducted with Sec62

• Localized function assessment:

  • If localization is determined, focus on compartment-specific functions

  • For ER-localized proteins, examine roles in protein translocation or quality control

This multi-faceted approach increases the probability of discovering phenotypes that reveal SPCC622.06c function, even if it has redundancy with other proteins.

What phenotypic assays would be most informative for SPCC622.06c knockout studies?

For comprehensive phenotypic characterization of SPCC622.06c deletion strains, implement these methodological approaches:

• Growth and viability assays:

  • Growth curves under standard conditions and various stressors

  • Spot assays on media containing membrane-perturbing agents

  • Chronological and replicative lifespan analysis

• Membrane integrity assessment:

  • Dye exclusion assays (e.g., propidium iodide)

  • Sensitivity to detergents, cell wall-disrupting enzymes

  • Membrane fluidity measurements using fluorescent probes

• Cell cycle and morphology analysis:

  • Cell size and shape measurements

  • Cell cycle progression monitoring using flow cytometry

  • Septation and cytokinesis defect screening

  • Connection to cell cycle-regulated processes in S. pombe

• Organelle structure and function:

  • ER stress response (using UPR reporters)

  • Mitochondrial function and morphology

  • Vacuole/lysosome morphology

  • Protein trafficking assays

• Sensitivity to specific perturbations:

  • DNA damage response (relevant to BER pathways in S. pombe)

  • Nutrient starvation response

  • Temperature sensitivity

  • Oxidative stress response

Record all phenotypes quantitatively with appropriate statistical analysis, and verify that phenotypes can be complemented by reintroduction of wild-type SPCC622.06c to confirm specificity.

How can contradictory experimental results about SPCC622.06c be reconciled?

When faced with contradictory results in SPCC622.06c research, apply this systematic reconciliation approach:

• Methodological standardization:

  • Compare experimental conditions (media, temperature, growth phase)

  • Standardize genetic backgrounds and strain construction methods

  • Develop benchmark assays that can be reproduced across laboratories

• Multi-level analysis:

  • Integrate results from genomic, transcriptomic, proteomic, and phenotypic analyses

  • Consider whether contradictions reflect different aspects of multifunctional proteins

  • Examine temporal dynamics that might reveal condition-specific functions

• Genetic context examination:

  • Test for genetic background effects by introducing the same mutation in different strains

  • Identify potential compensatory mechanisms that mask phenotypes in certain conditions

  • Create sensitized backgrounds by combining with mutations in related pathways

• Molecular resolution approaches:

  • Use domain-specific mutations rather than complete gene deletions

  • Employ rapid protein depletion systems to distinguish direct from adaptive effects

  • Separate analysis of protein fractions (membrane-bound versus soluble pools)

• Environmental variable control:

  • Systematically test different growth phases and metabolic states

  • Consider effects of media components (nitrogen sources, carbon sources)

  • Examine responses to specific cellular stresses

This framework has been successfully applied to reconcile apparently contradictory results in fission yeast research, such as in the TSC pathway studies and cell cycle regulation .

What are the major challenges in characterizing putative membrane proteins like SPCC622.06c?

Membrane protein characterization faces several methodological challenges that require specialized approaches:

• Expression and purification obstacles:

  • Low expression levels in native contexts

  • Protein misfolding and aggregation during heterologous expression

  • Detergent selection critical for maintaining native structure

  • Difficulty maintaining stability during purification procedures

• Functional redundancy masking:

  • Multiple proteins may perform similar functions, obscuring single-deletion phenotypes

  • Compensatory mechanisms can activate upon gene deletion

  • Condition-specific functions may be missed in standard laboratory conditions

• Technical limitations in structural studies:

  • Challenges in obtaining sufficient protein for structural determination

  • Detergent micelles can interfere with structural techniques

  • Conformational dynamics critical to function but difficult to capture

• Lipid environment complexity:

  • Specific lipid requirements for proper folding and function

  • Membrane microdomain localization affecting function

  • Difficulties in recreating native membrane environments in vitro

• Integration of disparate data types:

  • Reconciling results from different experimental approaches

  • Connecting protein structure to cellular function

  • Translating observations between model systems

These challenges require combining traditional approaches with emerging technologies. Recent advances in cryo-electron microscopy, native mass spectrometry, and in-cell structural biology offer promising solutions for membrane protein characterization.

How can autophagy pathways inform the study of uncharacterized membrane proteins?

Research on membrane proteins like Sec62 provides valuable methodological frameworks for studying uncharacterized proteins like SPCC622.06c:

• Autophagy connection to cellular stress responses:

  • Sec62 research demonstrates membrane proteins can function in stress response pathways

  • SPCC622.06c may similarly participate in cellular homeostasis mechanisms

  • Experimental framework includes monitoring stress response pathways when SPCC622.06c is deleted or overexpressed

• Interaction detection approaches:

  • Sec62 was shown to interact with LC3 through co-immunoprecipitation and co-localization studies

  • Similar methods can determine if SPCC622.06c interacts with autophagy machinery

  • Proximity labeling methods successfully identified Sec62 interaction partners

• Subcellular dynamics analysis:

  • Studies showed Sec62 relocates during cellular stress

  • Time-lapse microscopy of tagged SPCC622.06c during various stresses may reveal similar dynamics

  • Co-localization with organelle markers during stress response provides functional clues

• Rescue experiments design:

  • Test whether SPCC622.06c can functionally replace Sec62 or other characterized membrane proteins

  • Examine if human membrane protein homologs (if identified) can complement SPCC622.06c deletion

• Pathway integration analysis:

  • Study how SPCC622.06c affects known cellular pathways like IRE1α-JNK signaling

  • Monitor effects on ER stress markers, autophagy flux, and organelle homeostasis

These methodological approaches successfully elucidated Sec62 function as "a critical molecule in maintaining and recovering ER homeostasis" and could similarly reveal the function of SPCC622.06c.