Recombinant Sorex araneus Serpin B10 (SERPINB10)

What is SERPINB10 and what are its fundamental biological functions?

SERPINB10 (Serpin Peptidase Inhibitor, Clade B Ovalbumin, Member 10) belongs to the serpin superfamily of protease inhibitors. Research indicates that SERPINB10 plays a significant role in immune responses, particularly in allergic inflammation pathways. Functionally, SERPINB10 contributes to the regulation of Th2 cell viability by inhibiting apoptosis, making it a critical factor in allergic responses and inflammation . The protein is highly expressed in tissues with eosinophilic inflammation, suggesting its involvement in inflammatory conditions.

What is the molecular structure of Sorex araneus SERPINB10?

Recombinant Sorex araneus SERPINB10 consists of 397 amino acids (AA 1-397). The full amino acid sequence is:

MDSLANSINQ FALEFSKKLA ETDEGKNIFF SPWGISTTLA MVYLGTKGTT ATQMAQVLQF
DTDQDVKSSP ENEKKRKVDL NSDQVGEIHF GFQKLISEIN NPSNTYVLKT ANGIYGEKTY
PFHNKYIEDI KTYFGAKPQS VNFVEDSDQI RKDINSWVES QTEGKIPNLL PDDAVDSATK
MVLVNALYFK GLWEHQFSVQ DTTEKPFRIN KTSSKPVQMM SMKKNLEVFH IEKPQATGLR
LDYKNRDLSL LLILPEDVCG LDQLEKAITY DQLSEWTSED MMEMYTVELH LPKFKLEQSY
DLKTTLASMG MSDAFNQSKA DFSGMSDERN LYLSNVFHKS FVEINEQGTE AAAGSASEIS
VRIKLPTIEI NADHPFIFFI RHNKTNSILF YGRFCSP

This primary structure confers the protein's functional characteristics and is essential for understanding its interactions with target proteases and other biological molecules.

What expression systems are used for producing recombinant SERPINB10?

Recombinant Sorex araneus SERPINB10 can be effectively expressed in yeast expression systems, which provide appropriate post-translational modifications . For research applications involving other species' SERPINB10, alternative expression systems include:

• E. coli (for basic applications)

• HEK-293 cells (for mammalian expression)

• Baculovirus-infected insect cells (for complex eukaryotic expression)

The choice of expression system should be based on the specific experimental requirements, considering factors such as protein folding, post-translational modifications, and yield.

How should experiments be designed to study SERPINB10's role in immune responses?

Based on current research methodologies, a comprehensive approach should include:

• In vitro studies: Utilize primary T-cell cultures with SERPINB10 knockdown (via shRNA) or overexpression systems to investigate effects on Th2 cell survival, proliferation, and cytokine production.

• In vivo models: Implement house dust mite (HDM)-induced allergic inflammation models in mice with AAV-mediated SERPINB10 knockdown to understand physiological roles .

• Expression analysis: Monitor SERPINB10 expression changes under various immune stimuli using RT-qPCR and Western blotting.

• Functional assays: Assess T-cell receptor activation effects on SERPINB10 expression using anti-CD3 antibody stimulation, as this has been shown to upregulate SERPINB10 expression specifically in polarized Th2 cells .

What knockdown strategies have proven effective for SERPINB10 research?

Two primary approaches have demonstrated efficacy:

• AAV-delivered shRNA for in vivo studies: The validated shRNA sequence GCAGAACCACAATCTGTTAACTTCAAGAGAGTTAACAGATTGTGGTTCTGCTTTTTT has shown efficiency in mouse models. Administration via intranasal route at 10^12 viral particles/mL provides effective knockdown .

• Lentiviral shRNA for in vitro studies: The sequence GCCTGTTAACTTTGTGGAA has been successfully used to transduce CD4+ T cells. Optimal transduction involves centrifugation at 500× g for 90 minutes at room temperature with polybrene (6 μg/mL) .

For both approaches, knockdown efficiency should be validated at both mRNA and protein levels using RT-qPCR and Western blotting, respectively.

What are the recommended methods for quantifying SERPINB10 expression?

For RT-qPCR analysis, appropriate housekeeping genes must be selected for normalization, and for protein analysis, expression should be normalized to total protein or established loading controls .

How does SERPINB10 regulate T-helper cell apoptosis at the molecular level?

Research indicates that SERPINB10 inhibits apoptosis of Th2 cells, but not Th1 cells, suggesting specificity in its anti-apoptotic function . While the precise molecular mechanism requires further investigation, available data suggests:

• SERPINB10 expression is upregulated specifically in polarized Th2 cells following T-cell receptor stimulation with anti-CD3 antibody.

• Knockdown of SERPINB10 results in increased apoptosis of Th2 cells, indicating its protective role against programmed cell death.

• The effect appears to be Th2-specific, as similar manipulations do not affect Th1 cell populations.

Further mechanistic studies should explore interactions with known apoptotic pathways, including potential inhibition of specific proteases involved in apoptotic cascades.

What is the significance of SERPINB10 polymorphisms in disease susceptibility?

Research has identified two coding SNPs (rs8097425 and rs963075) in SERPINB10 with significant associations to prostate cancer in a Japanese cohort . These SNPs, together with three SNPs in SERPINB2, form a haplotype block that may influence disease susceptibility.

For researchers investigating SERPINB10 in disease contexts, considerations should include:

• Genotyping these key SNPs in study populations

• Assessing how these polymorphisms affect protein structure and function

• Determining population-specific distribution of these variants

• Investigating potential linkage with other disease-associated loci

Functional studies examining how these polymorphisms affect SERPINB10's protease inhibitory activity or expression patterns would provide valuable insights into disease mechanisms.

How does SERPINB10 contribute to allergic inflammation in asthma models?

Knockdown studies in mouse models have revealed that SERPINB10 plays multiple roles in allergic inflammation:

• Inflammatory cell recruitment: SERPINB10 knockdown significantly reduced the number of total cells, lymphocytes, eosinophils, and neutrophils in bronchoalveolar lavage fluid (BALF) following HDM challenge .

• Th2 response modulation: SERPINB10 knockdown diminished HDM-induced Th2 cytokine secretion and levels of HDM-specific IgE .

• Tissue remodeling: Mice with SERPINB10 knockdown showed reduced goblet-cell hyperplasia and mucus secretion after HDM challenge .

• Cellular mechanism: SERPINB10 appears to enhance the Th2 response by preventing apoptosis of allergen-specific Th2 cells, thereby prolonging their inflammatory effects .

These findings suggest SERPINB10 as a potential therapeutic target for allergic asthma and related conditions.

How can SERPINB10 serve as a biomarker in inflammatory conditions?

SERPINB10 expression levels have demonstrated significant potential as clinical biomarkers, particularly in Chronic Rhinosinusitis with Nasal Polyps (CRSwNP). Research findings reveal:

• Tissue SERPINB10 mRNA levels were significantly elevated in CRSwNP patients, especially in those who experienced recurrence .

• SERPINB10 expression strongly correlates with the degree of tissue eosinophilic inflammation .

• ROC curve analysis demonstrated that tissue SERPINB10 mRNA levels (AUC = 0.773, 95% CI 0.625-0.921, p < 0.001) have stronger predictive capability for CRSwNP recurrence than tissue eosinophil percentage (AUC = 0.741, 95% CI 0.612-0.871, p = 0.002) .

• A combination of tissue SERPINB10 mRNA levels and tissue eosinophil percentage offers even greater predictive efficacy (AUC = 0.917, 95% CI 0.845-0.989, p < 0.001) .

These findings suggest that SERPINB10 quantification could be incorporated into clinical assessment algorithms for predicting treatment outcomes and recurrence risk.

What statistical approaches should be used when analyzing SERPINB10 in clinical studies?

Based on published methodologies, the following statistical approaches are recommended:

• For normally distributed variables: Student's t-test (two groups) or ANOVA (three or more groups) .

• For non-normally distributed variables: Mann-Whitney U test or Wilcoxon rank sum test .

• For correlation analysis: Spearman's rank correlation to examine relationships between tissue SERPINB10 mRNA and clinical variables .

• For predictive modeling: Binary logistic regression analysis to confirm relationships between SERPINB10 expression and clinical outcomes .

• For biomarker evaluation: Receiver operating characteristic (ROC) curves to assess predictive capacity, with calculation of area under the curve (AUC), sensitivity, specificity, and optimal cut-off values .

Statistical software such as SPSS (version 25.0 or newer) is suitable for these analyses, with statistical significance typically set at p < 0.05.

What are the optimal conditions for maintaining recombinant SERPINB10 stability?

Though specific stability data for Sorex araneus SERPINB10 is limited, general guidelines for serpin proteins include:

• Storage temperature: -80°C for long-term storage; -20°C with 15-25% glycerol for medium-term storage.

• Buffer composition: Phosphate-buffered saline (PBS) with protease inhibitors is typically suitable for most applications.

• Avoid denaturation: Minimize freeze-thaw cycles, as serpins are susceptible to conformational changes that can lead to polymerization or latency.

• Working concentrations: Dilute to working concentration immediately before use; avoid prolonged storage of diluted protein.

• Quality control: Periodic functional assays to ensure the protein retains its inhibitory activity over time.

How can researchers validate the functionality of recombinant SERPINB10?

Functional validation should include multiple approaches:

• Protease inhibition assays: Test SERPINB10's ability to inhibit its target proteases by measuring residual protease activity after incubation with SERPINB10.

• Cell-based assays: Assess the effect of purified SERPINB10 on Th2 cell apoptosis, which should be reduced in the presence of functional protein .

• Structural integrity assessment: Circular dichroism spectroscopy can verify proper protein folding.

• Binding studies: Surface plasmon resonance or co-immunoprecipitation to confirm interaction with known binding partners.

• Thermal stability assays: Differential scanning fluorimetry to assess protein stability and proper folding.

What are the key unanswered questions regarding SERPINB10 function?

Several important research questions remain to be addressed:

• What are the specific target proteases inhibited by SERPINB10, and how does this inhibition relate to its anti-apoptotic effects in Th2 cells?

• What signaling pathways connect T-cell receptor activation to SERPINB10 upregulation specifically in Th2 cells?

• How do SERPINB10 polymorphisms affect protein function and disease susceptibility across different populations?

• Can SERPINB10 inhibition be developed as a therapeutic strategy for allergic diseases, and what would be the optimal targeting approach?

• What is the evolutionary conservation of SERPINB10 function across species, and how does this inform our understanding of its biological roles?

What novel methodologies might advance SERPINB10 research?

Emerging technologies that could significantly advance our understanding of SERPINB10 include:

• CRISPR-Cas9 genome editing: For creating precise knockouts or mutations to study SERPINB10 function in cellular and animal models.

• Single-cell transcriptomics: To identify cell populations expressing SERPINB10 and understand heterogeneity in expression patterns.

• Cryo-electron microscopy: To determine the three-dimensional structure of SERPINB10 and its complexes with target proteases.

• Intravital imaging: To visualize SERPINB10 activity in living tissues during inflammatory responses.

• Systems biology approaches: To integrate SERPINB10 into broader protein-protein interaction networks and cellular pathways.

These methodologies, combined with traditional biochemical and immunological techniques, will provide a more comprehensive understanding of SERPINB10's roles in health and disease.