Recombinant Staphylococcus aureus Probable tautomerase SAR1376 (SAR1376)

What is SAR1376 and what structural features make it valuable for research?

SAR1376 is a 62 amino acid protein from Staphylococcus aureus that belongs to the 4-oxalocrotonate tautomerase (4-OT) family. Its notable feature is the ability to form a hexameric structure that measures less than 5 nm in size . The protein has gained research interest due to its compact multimeric arrangement, which makes it particularly valuable as a scaffolding domain for antigen presentation. The small size of SAR1376 compared to other scaffolding proteins (such as QacR, which forms structures greater than 20 nm) provides significant advantages for protein engineering and vaccine design applications . The hexameric structure is crucial for its adjuvant effect, as mutations disrupting this multimeric assembly abrogate its immune-enhancing properties.

How does the amino acid sequence of SAR1376 relate to its function?

The amino acid sequence of SAR1376 is:
ATGCCCATCGTGAACGTGAAGCTGCTGGAAGGCAGAAGCGACGAGCAGCTGAAGAACCTGGTGTCCGAAGTGACCGACGCCGTGGAAAAGACCACCGGCGCCAACAGACAGGCCATCCACGTCGTGATCGAGGAAATGAAGCCCAACCACTACGGCGTGGCCGGCGTGCGGAAAAGCGATCAGTGATGA

The sequence encodes specific residues critical for multimerization. Research has demonstrated that point mutations, such as P1A and R35A, can significantly impact the protein's function. For instance, the P1A mutation (where the proline at position 1 is replaced with alanine) alters the protein's ability to enhance immune responses when fused to antigens . The research methodology typically involves site-directed mutagenesis followed by structural and functional assays to determine how specific amino acid changes affect hexamer formation and subsequent immune enhancement capabilities.

How does SAR1376 enhance immunogenicity when fused to antigens?

SAR1376 functions as a pro-immunogenic scaffold that enhances immune responses when fused to various antigens. Studies have demonstrated that this enhancement occurs through the multimeric presentation of antigens, which appears to improve recognition by the immune system . The hexameric structure formed by SAR1376 creates a multivalent display of the fused antigen, potentially increasing B-cell receptor cross-linking and subsequent antibody production.

Experimental evidence shows that SAR1376 maintains its pro-immunogenic properties across multiple vaccination platforms. It enhances immune responses when delivered through DNA vaccination, viral vector vaccines, or as protein-in-adjuvant formulations . Importantly, SAR1376's immune-enhancing effect does not depend on its enzymatic activity but rather on its structural properties, specifically the hexameric assembly. Mutations that disrupt this hexameric structure eliminate the adjuvant effect, confirming the critical importance of multimerization for immune enhancement .

What antigens have been successfully fused with SAR1376 in research studies?

Research has demonstrated that SAR1376 can enhance immune responses when fused to a diverse range of pathogen antigens from both S. aureus and P. falciparum . Specific antigens tested include:

• From S. aureus:

  • BitC (a cell surface lipoprotein)

  • ClfB (Clumping factor B precursor, extracellular domain)

  • Truncated alpha-hemolysin (Hla)

• From P. falciparum (malaria parasite):

  • Various unspecified antigens that showed enhanced immunogenicity when fused to SAR1376

The versatility of SAR1376 as a scaffold for different antigens suggests its potential application in developing vaccines against multiple pathogens. Experimental approaches typically involve genetic fusion of SAR1376 to the C-terminus of the target antigen, followed by expression in appropriate systems and evaluation of immune responses in mouse models .

What are the optimal methods for expressing and purifying recombinant SAR1376 fusion proteins?

The expression and purification of SAR1376 fusion proteins requires careful consideration of several factors to maintain the protein's hexameric structure and functional properties. Based on research protocols, the following methodological approach is recommended:

For expression:

• Design constructs with SAR1376 fused to either the N-terminus or C-terminus of the target antigen, with appropriate linker sequences

• Clone the fusion construct into a suitable expression vector (mammalian, bacterial, or viral depending on the application)

• For protein production, bacterial expression systems using E. coli strains such as BL21(DE3) are commonly employed with IPTG induction

• For DNA vaccination or viral vector approaches, use appropriate mammalian expression vectors with strong promoters

For purification:

• Employ affinity chromatography (typically His-tag based purification)

• Follow with size exclusion chromatography to isolate properly formed hexameric complexes

• Verify multimeric status using analytical techniques such as native PAGE or dynamic light scattering

• Confirm functionality through in vitro binding assays or structural analysis

The choice between different expression systems depends on the specific research application. For vaccine studies, both protein-based approaches and genetic vaccines (DNA or viral vectors) have proven effective with SAR1376 fusion constructs .

How can researchers effectively evaluate the immune enhancement properties of SAR1376 fusions?

Systematic evaluation of SAR1376-mediated immune enhancement requires a multi-faceted approach:

• Immunization protocols:

  • Prime-boost regimens are typically employed (e.g., two-week intervals between immunizations)

  • Multiple delivery platforms can be tested: DNA vaccination, viral vectors, or protein-in-adjuvant formulations

  • Include proper controls: antigen alone (without scaffold) and antigen fused to other known scaffold proteins (e.g., IMX313)

• Immune response assessment:

  • Antibody responses: Measure antigen-specific antibody titers using ELISA, with careful separation of anti-scaffold and anti-antigen responses

  • T-cell responses: Evaluate using ELISpot or intracellular cytokine staining to assess T-cell activation profiles

  • Functional assays: Depending on the antigen, conduct neutralization or opsonophagocytic assays to determine functional antibody quality

• Statistical analysis:

  • Compare responses between SAR1376-fused antigens and appropriate controls

  • Account for individual variations in immune responses among experimental animals

  • Apply appropriate statistical tests (e.g., Mann-Whitney for non-parametric data)

Research has demonstrated that the immune enhancement effect of SAR1376 may vary depending on the antigen and delivery method. For instance, SAR1376 fusion enhanced BitC immunogenicity modestly when delivered via DNA vaccination, but the enhancement was more pronounced with ClfB and Hla antigens .

How do mutations in the SAR1376 sequence affect its scaffolding properties?

Mutation studies provide critical insights into the structure-function relationship of SAR1376. Research has identified key mutations that significantly impact SAR1376's pro-immunogenic properties:

The experimental approach to studying these mutations typically involves:

• Site-directed mutagenesis to create specific amino acid substitutions

• Expression and purification of mutant proteins

• Structural analysis using techniques such as X-ray crystallography, circular dichroism, or size exclusion chromatography

• Functional assessment through immunization studies comparing wild-type and mutant SAR1376 fusions

These mutation studies have conclusively demonstrated that the hexameric structure is essential for SAR1376's adjuvant effect, as mutations disrupting this structure eliminate the immune-enhancing properties. This provides mechanistic insight into how SAR1376 functions as a scaffold protein and guides rational design of improved variants .

What are the advantages of SAR1376 over other scaffolding domains for vaccine development?

SAR1376 offers several distinct advantages compared to other scaffolding domains:

• Size efficiency: At just 62 amino acids, SAR1376 is significantly smaller than many other scaffolding proteins while still forming stable hexameric structures measuring less than 5 nm. This compactness may benefit expression efficiency and reduce potential antigen masking .

• Versatility across delivery platforms: SAR1376 demonstrates pro-immunogenic effects when delivered via DNA vaccination, viral vector vaccines, or as protein-in-adjuvant formulations, providing flexibility in vaccine design approaches .

• Broad antigen compatibility: Research has shown SAR1376 enhances immune responses when fused to antigens from different pathogens (S. aureus and P. falciparum), suggesting wide applicability .

• Potential reduced anti-scaffold immunity: Smaller scaffolds may induce less anti-scaffold immunity, a significant concern with larger scaffolding domains where pre-existing or induced anti-scaffold responses can inhibit immune responses to the antigen-scaffold combination .

• Structural independence: Unlike some scaffolds requiring specific folding conditions or post-translational modifications, SAR1376's self-multimerizing properties appear robust across expression systems .

When compared to other scaffolds such as Dps, QacR, and SA1388, SAR1376 demonstrated superior immune enhancement for certain antigens, particularly in DNA vaccination formats. This suggests that despite its small size, SAR1376 provides effective multimeric presentation of antigens to the immune system .

How might SAR1376 be incorporated into multi-antigen vaccine development strategies?

SAR1376 shows significant potential for multi-antigen vaccine development through several strategic approaches:

• Multiple antigen fusion approach:

  • Sequential fusion of SAR1376 to multiple antigens within a single construct

  • Creation of chimeric antigens combining protective epitopes from different targets, followed by SAR1376 fusion

  • Development of multivalent vaccines expressing several SAR1376-antigen fusions simultaneously

• Application to S. aureus vaccine development:

  • SAR1376 could be particularly valuable for S. aureus vaccines, where protection likely requires immune responses against multiple virulence factors

  • Potential antigens for SAR1376 fusion include staphylococcal protein A (SpA), α-haemolysin (Hla), iron surface determinant B N2 domain (IsdB-N2), staphylococcal enterotoxin B (SEB), and manganese transport protein C (MntC)

  • These combinations could address the complex pathogenesis of S. aureus infections by targeting multiple virulence mechanisms simultaneously

• Methodological considerations:

  • Optimal spacing between antigens and SAR1376 requires empirical determination

  • Expression systems must be carefully selected to ensure proper folding and assembly of complex multiantigen constructs

  • Immunization regimens may need optimization to maximize responses against all components

The development of SAR1376-enhanced multi-antigen vaccines represents a promising approach to address pathogens requiring complex immune responses for protection.

What are the critical research questions that remain unanswered about SAR1376's mechanism of action?

Despite significant advances in understanding SAR1376's adjuvant properties, several critical research questions remain:

• Detailed mechanism of immune enhancement:

  • How exactly does SAR1376 multimerization influence antigen processing and presentation?

  • Does SAR1376 affect dendritic cell activation, antigen uptake, or processing pathways?

  • What is the impact on germinal center formation and affinity maturation?

• Structure-function relationships:

  • Beyond the hexameric structure, what specific molecular features of SAR1376 contribute to its adjuvant effect?

  • Are there key interaction surfaces that could be engineered for enhanced activity?

  • How does the spatial arrangement of fused antigens on the SAR1376 scaffold impact immunogenicity?

• Cross-species applicability:

  • Would SAR1376-based vaccines demonstrate similar enhancement effects in larger animal models and humans?

  • How does pre-existing immunity to S. aureus affect the utility of SAR1376 as a vaccine scaffold in humans?

• Optimization strategies:

  • Can SAR1376 be engineered to further enhance its adjuvant properties?

  • What is the optimal positioning of antigens relative to the SAR1376 scaffold?

  • How do different delivery methods affect the stability and immunogenicity of SAR1376-antigen fusions?

Addressing these questions will require interdisciplinary approaches combining structural biology, immunology, and vaccine technology. Future research directions might include cryo-electron microscopy studies of SAR1376-antigen complexes, detailed analysis of immune cell interactions, and translational studies in larger animal models .

What are common challenges when working with SAR1376 fusions and how can they be addressed?

Researchers working with SAR1376 fusion proteins may encounter several technical challenges:

• Expression and solubility issues:

  • Challenge: Some antigen-SAR1376 fusions may express poorly or form insoluble aggregates.

  • Solution: Optimize codon usage for the expression system, test different fusion orientations (N- vs C-terminal fusions), incorporate flexible linkers between the antigen and SAR1376, and adjust expression conditions (temperature, inducer concentration) .

• Hexamer formation verification:

  • Challenge: Confirming proper hexameric assembly of SAR1376 fusions.

  • Solution: Employ size exclusion chromatography, native PAGE, dynamic light scattering, or analytical ultracentrifugation to verify the multimeric state. For more detailed structural analysis, negative-stain electron microscopy or X-ray crystallography may be required .

• Distinguishing scaffold vs. antigen responses:

  • Challenge: Separating immune responses against the SAR1376 scaffold from those directed at the target antigen.

  • Solution: Include appropriate controls (antigen alone, irrelevant antigen-SAR1376 fusion) in immunological assays, and use purified antigen (without scaffold) for antibody titer determination .

• Maintaining functionality of complex antigens:

  • Challenge: Ensuring that fusion to SAR1376 doesn't disrupt critical epitopes or functional domains of the antigen.

  • Solution: Carefully design fusion constructs with knowledge of the antigen's structure, potentially incorporating longer linkers or testing different fusion points to preserve antigen conformation .

How should researchers design experiments to compare SAR1376 with other scaffolding approaches?

Robust experimental design for comparative scaffold evaluation should include:

• Standardized construct design:

  • Create parallel constructs with identical antigens fused to different scaffolds

  • Maintain consistent linker sequences and fusion orientations when possible

  • Include unscaffolded antigen and irrelevant scaffold-antigen fusions as controls

• Multi-platform evaluation:

  • Test constructs across different delivery systems (DNA, viral vectors, protein)

  • Evaluate expression levels and proper folding in each system

  • Assess stability and homogeneity of purified proteins

• Comprehensive immunological assessment:

  • Measure both quantitative (antibody titers, T-cell numbers) and qualitative (antibody functionality, T-cell phenotypes) parameters

  • Include long-term studies to assess durability of responses

  • Where applicable, include challenge studies to assess protection

• Comparative analysis framework:

  • Establish clear metrics for scaffold performance (e.g., fold-increase in antibody titers, protection rates)

  • Consider practical factors such as ease of production, stability, and cost

  • Analyze data using appropriate statistical methods to determine significant differences

Research has shown that when compared to other scaffolds like Dps, QacR, and SA1388, SAR1376 demonstrated superior immune enhancement for certain antigens. For example, mice vaccinated with Dps-scaffold fusions responded poorly against BitC, while SAR1376 fusions increased immunogenicity. Such comparative analyses are crucial for identifying the most effective scaffolding approach for specific vaccine applications .