Recombinant Staphylococcus saprophyticus subsp. saprophyticus UPF0754 membrane protein SSP0953 (SSP0953)

What expression systems are typically used for recombinant SSP0953 production?

Multiple expression systems can be utilized for recombinant SSP0953 production, each with particular advantages depending on research objectives:

How does the presence of N-terminal tags affect SSP0953 expression?

The addition of N-terminal tags, particularly His-tags, can significantly influence SSP0953 expression levels. Research indicates that His-tagged constructs may generate a minimum 1.5-fold increase in target protein synthesis compared to untagged versions . This enhancement is attributed to changes in the 5′ mRNA secondary structure that facilitate translation initiation.

In silico mRNA analyses using tools like TIsigner and RNAfold demonstrate that His-tag addition can decrease the 5′ mRNA opening energy, creating secondary structures that are more accessible to ribosomes and thus enabling more efficient translation . For optimal expression, the design of the 5′ region is crucial, as even synonymous mutations in this region can alter mRNA folding and significantly impact protein production levels.

What are the optimal cloning strategies for SSP0953 expression?

For efficient cloning and expression of SSP0953, several strategic approaches have demonstrated success:

• Vector Selection: pET expression vectors (such as pET His6 2Bc-T) are commonly used for SSP0953 expression in E. coli systems, offering strong inducible promoters and fusion tag options .

• Ligation-Independent Cloning (LIC): This method has proven effective for SSP0953 cloning, using primers designed to create compatible overhangs on insert and vector :

  • Insert Forward Primer: CCAGCGGCGGT GCCACCATGAGGGTC

  • Insert Reverse Primer: GAGCCCGAGGAGCT AGAATTCTTTGTCTTTTTCCAAAC

  • Vector Reverse Primer: CCGCCGCTGGA GGTTTCGGACCGAGATC

  • Vector Forward Primer: GCTCCTCGGGCTCA GGTACCGATTACGATATCCC

• Positive Selection Systems: Novel approaches like the pGRASS (Green fluorescent protein Reporter from Antisense promoter-based Screening System) vector system can be adapted for SSP0953 cloning, allowing for efficient screening of recombinant clones directly on agar plates through visual identification .

• Baculovirus Expression System: For higher eukaryotic expression, the gene can be cloned between mini Tn7 elements in a pFastBac donor plasmid, followed by transposition into a bacmid for insect cell expression .

The selection of cloning strategy should align with downstream applications and required protein characteristics.

What culture conditions optimize recombinant SSP0953 production?

Optimizing culture conditions is crucial for maximizing SSP0953 yield and quality. Based on studies of recombinant membrane protein expression:

These conditions can be fine-tuned using statistical methods such as response surface methodology (RSM) to identify optimal concentrations of supplements that enhance membrane permeability and protein secretion . Monitoring plasmid stability throughout cultivation is essential, as high-level expression can create selective pressure against plasmid maintenance .

How can protein solubility be improved when expressing SSP0953?

As a membrane protein, SSP0953 poses solubility challenges during recombinant expression. Several strategies can address this issue:

• Fusion Tags: Beyond purification, fusion partners like MBP (maltose-binding protein), GST (glutathione S-transferase), or SUMO can enhance solubility by acting as chaperones during protein folding .

• Host Strain Selection: E. coli strains like Origami B (DE3) with enhanced disulfide bond formation capabilities can improve proper folding of SSP0953 .

• Co-expression with Chaperones: Co-expressing molecular chaperones (GroEL/GroES, DnaK/DnaJ/GrpE) can facilitate proper protein folding.

• Directed Evolution Approach: Implementing synonymous codon changes in the 5′ region of the gene can significantly impact mRNA secondary structure and improve translation efficiency. In silico analysis tools can predict beneficial modifications before experimental implementation .

In one comparative study, optimizing the 5′ mRNA region through synonymous mutations resulted in improved SSP0953 production even without fusion tags, demonstrating the importance of transcript structure in protein expression .

What is the putative function of SSP0953 in S. saprophyticus?

While the specific function of SSP0953 remains under investigation, comparative genomic analyses and experimental evidence suggest several potential roles:

• Membrane Structure: As a UPF0754 family membrane protein, SSP0953 likely contributes to membrane integrity and organization .

• Potential Relation to Surface-Associated Proteins: Studies of S. saprophyticus surface-associated proteins (Ssp) indicate that some membrane proteins function as surface-exposed enzymes with lipase activity, potentially contributing to virulence . While direct evidence linking SSP0953 to lipase activity is lacking, structural analysis suggests potential functional similarities.

• Biofilm Formation: S. saprophyticus strains demonstrate high rates of biofilm formation (91% of isolates), with varying matrix composition. The role of specific membrane proteins, potentially including SSP0953, in this process warrants further investigation .

Advanced techniques such as gene knockout studies, protein-protein interaction assays, and Caenorhabditis elegans pathogenicity models could elucidate the precise function of SSP0953 in bacterial physiology and potential virulence .

How does SSP0953 compare to other membrane proteins in Staphylococcus species?

Comparative genomic analysis reveals that SSP0953 belongs to a family of proteins with varying conservation across Staphylococcus species:

Phylogenetic analysis suggests that while SSP0953 shares some sequence similarity with proteins in other staphylococcal species, its specific function may have diverged during evolution . The protein appears to have been vertically transmitted during speciation rather than horizontally acquired, as evidenced by its conserved genomic context in related species .

Unlike some other staphylococcal membrane proteins such as those encoded by the ica gene cluster (which can be horizontally transferred), SSP0953 shows a more consistent evolutionary pattern within the S. saprophyticus lineage .

How can researchers address contradictions in experimental data when working with SSP0953?

When conflicting results emerge during SSP0953 characterization, a structured approach to data contradiction analysis is recommended:

• Classify Contradiction Patterns: Apply a (α, β, θ) notation system where α represents the number of interdependent experimental variables, β indicates the number of contradictory dependencies identified, and θ represents the minimal number of Boolean rules needed to assess these contradictions .

• Weighted Reconciliation Method: When multiple estimates of a single parameter exist (e.g., protein quantification, activity measurements), employ a weighted arithmetic average with the inverse of uncertainties as weights, and use a harmonic average for reconciling uncertainty values :

  For best guess reconciliation: X = Σ(X_i/σ_i²)/Σ(1/σ_i²)
  Where X_i represents individual estimates and σ_i their uncertainties

• Identify Theory-Laden Observations: Recognize that confirmation bias may influence data interpretation. Maintain awareness that observation is theory-laden and work deliberately to consider alternative explanations for unexpected results .

• Implement Multi-Team Analysis: When critical results show contradictions, have independent research teams analyze the same dataset using different methodological approaches to identify potential sources of variation .

This structured approach allows for more rigorous evaluation of contradictory findings and can potentially lead to novel insights about SSP0953 function and properties.

What methodological approaches are recommended for studying SSP0953 interactions with host cells?

Investigating interactions between SSP0953 and host cells requires sophisticated experimental approaches:

• Recombinant SSP0953 Labeling Strategies:

  • Fluorescent protein fusions (ensuring function is preserved)

  • Site-specific incorporation of unnatural amino acids for click chemistry labeling

  • Isotope labeling for NMR studies of interaction dynamics

• Cell-Based Assays:

  • Virulence assessment using C. elegans infection models, which have shown value in studying Staphylococcus virulence factors such as Ssp

  • Adhesion assays using human cell lines relevant to S. saprophyticus infection sites

  • Biofilm formation assays with wild-type and SSP0953 mutants to assess contribution to microbial community development

• Structure-Function Analysis:

  • Site-directed mutagenesis of key residues to identify functional domains

  • Creation of chimeric proteins with other staphylococcal membrane proteins to map interaction regions

  • Truncation series to delineate the minimal functional domain

• Computational Analysis:

  • Molecular dynamics simulations of SSP0953 in membrane environments

  • Docking studies with potential interaction partners

  • Prediction of post-translational modifications that might regulate function

These methodological approaches should be selected based on specific research questions and available resources, with particular attention to preserving the native structure and environment of this membrane protein.

What are the challenges in developing antibodies against SSP0953 for research applications?

Developing antibodies against membrane proteins like SSP0953 presents unique challenges:

• Antigen Preparation Challenges:

  • Limited solubility in aqueous solutions requires detergent stabilization

  • Difficulty preserving native conformation during purification

  • Limited surface-exposed epitopes for antibody recognition

• Immunization Strategies:

  • Peptide-based approaches targeting predicted extracellular loops

  • DNA immunization expressing the full-length protein in vivo

  • Proteoliposome preparation to present the protein in a membrane-like environment

• Validation Methodology:

  • Western blotting with appropriate controls (recombinant protein, knockout strains)

  • Immunofluorescence to confirm specificity and accessibility of epitopes

  • Flow cytometry with intact bacteria to verify surface accessibility

• Cross-Reactivity Concerns:

  • Potential recognition of homologous proteins in related staphylococcal species

  • Specificity testing against a panel of related bacteria

  • Absorption controls with recombinant protein to confirm specificity

When selecting antibody development approaches, researchers should consider the intended application (Western blot, immunoprecipitation, neutralization) as this will dictate the required antibody characteristics and appropriate validation methods.

How can researchers ensure reproducibility when working with recombinant SSP0953?

Ensuring reproducibility in SSP0953 research requires systematic documentation and standardization:

• Construct Verification:

  • Complete sequencing of expression constructs, including vector-insert junctions

  • Verification of reading frame and absence of unintended mutations

  • Documentation of expression vector features (promoters, tags, terminators)

• Expression Parameter Standardization:

  • Detailed recording of media composition, including lot numbers of complex components

  • Precise documentation of growth conditions (temperature profiles, oxygen transfer rates)

  • Consistent induction protocols with controlled cellular density at induction

• Purification Protocol Standardization:

  • Defined buffer systems with pH measurement before and after preparation

  • Column performance validation using standard proteins

  • Detailed fractionation and pooling criteria

• Activity Assay Calibration:

  • Use of stable reference standards across experiments

  • Temperature and pH monitoring during assays

  • Multiple technical and biological replicates with statistical analysis

Implementation of electronic laboratory notebooks with standardized templates for SSP0953-related protocols can significantly enhance reproducibility across different research groups and over time.

What bioinformatic tools are most useful for analyzing SSP0953 sequence and structure?

Several bioinformatic tools are particularly valuable for SSP0953 analysis:

The integration of results from multiple tools provides more robust predictions than reliance on any single method. For example, combining transmembrane topology predictions with evolutionary conservation analysis can identify functionally important residues within membrane-spanning regions.

How does the mRNA secondary structure affect recombinant SSP0953 expression?

The 5′ mRNA secondary structure significantly impacts recombinant SSP0953 expression efficiency:

This understanding provides a rational basis for construct design, suggesting that in silico mRNA analysis should be incorporated into the design process for recombinant SSP0953 expression systems.

What emerging technologies might advance SSP0953 research?

Several cutting-edge technologies hold promise for deepening our understanding of SSP0953:

• Cryo-Electron Microscopy: High-resolution structural determination of membrane proteins in near-native environments could reveal the precise conformation and interactions of SSP0953 within the membrane.

• Single-Cell Proteomics: Examination of SSP0953 expression levels and modifications at the single-cell level could reveal heterogeneity in bacterial populations that may be relevant to stress responses or virulence.

• CRISPR-Cas Systems for Staphylococci: Refined genome editing tools allow for precise modification of SSP0953 in its native genomic context, enabling detailed structure-function studies without the complications of recombinant expression.

• Nanobody Development: Single-domain antibodies derived from camelids offer advantages for recognizing conformational epitopes of membrane proteins and can be used as crystallization chaperones for structural studies.

• Cell-Free Expression Systems: Specialized membrane protein expression systems using nanodiscs or lipid bilayers may overcome challenges associated with traditional recombinant expression approaches.

These technologies could address current limitations in SSP0953 research and open new avenues for understanding its function and potential applications.

How might SSP0953 research contribute to understanding staphylococcal pathogenesis?

Understanding SSP0953 may provide valuable insights into staphylococcal pathogenesis through several mechanisms:

• Biofilm Formation: Given that S. saprophyticus demonstrates high rates of biofilm formation (91% of isolates), and membrane proteins often contribute to this process, characterizing SSP0953's potential role could reveal new targets for disrupting bacterial persistence .

• Comparative Pathogenesis: Investigating differences in SSP0953 structure and function between commensal and pathogenic staphylococcal strains could illuminate evolutionary adaptations that contribute to virulence.

• Host-Pathogen Interactions: If SSP0953 plays a role in bacterial adhesion or invasion, similar to some other staphylococcal surface proteins, it may represent an underexplored virulence factor.

• Environmental Adaptation: Understanding how SSP0953 contributes to bacterial survival in different environments (including the urinary tract, where S. saprophyticus is a common pathogen) could reveal mechanisms of bacterial adaptation to host niches.

• Protein Acquisition and Evolution: Studying the evolutionary history of SSP0953 in comparison to horizontally acquired virulence factors (like ica genes) could provide insight into different mechanisms of virulence acquisition in staphylococci .

This research could ultimately contribute to new approaches for preventing or treating staphylococcal infections by targeting conserved membrane proteins essential for bacterial pathogenesis.