Recombinant Sulfolobus solfataricus TATA-box-binding protein (tbp)

Shipped with Ice Packs
In Stock

Description

Molecular Cloning and Production

Recombinant S. solfataricus TBP is produced by cloning the gene (SSO0006 in the genome ) into expression vectors. Key parameters include:

ParameterDetails
PrimersTBP-F (GATCGGATCCGCAACAGTTACGTTAGAGCAG) and TBP-R (GATCAAGCTTTTAGAGCTCTAACTCTTCCTC)
Expression VectorpQE30-Xa (Qiagen) with BamHI/HindIII sites
Host StrainM15-pREP4 E. coli cells
Purification MethodNondenaturing conditions using nickel-nitrilotriacetic acid (Ni-NTA) affinity chromatography

This system yields His₆-tagged TBP, which retains DNA-binding activity and compatibility with in vitro transcription assays .

Biochemical Characteristics

  • DNA Binding Specificity: TBP binds the archaeal A-box (TATA-box analog) upstream of promoters via sequence-specific interactions. Structural studies suggest this binding induces DNA bending, facilitating RNA polymerase recruitment .

  • Thermostability: Native TBP remains stable under extreme temperatures (76–90°C), with no degradation observed during heat shock experiments .

  • Interactions:

    • Directly associates with RNA polymerase and transcription factor E (TFE) .

    • Forms ternary complexes with transcription factor B (TFB1) on promoter DNA .

Functional Role in Transcription

Recombinant TBP is indispensable for in vitro transcription initiation. Key findings include:

Promoter-Specific Activity

  • Core Promoters: TBP-TFB1 complexes recruit RNA polymerase to BRE (TFB1-binding) and A-box motifs, enabling basal transcription .

  • TFE Synergy: TFE enhances TBP’s DNA-binding efficiency on suboptimal TATA-box sequences (e.g., those with G/C substitutions) by stabilizing TBP-DNA interactions .

Regulatory Dynamics

  • mRNA Stability: Under 90°C heat shock, TBP mRNA levels decrease 2.6-fold over 60 minutes, but protein levels remain constant, suggesting post-transcriptional regulation .

  • Stress Resistance: TBP is unaffected by oxidative stress (H₂O₂) or DNA damage (mitomycin C), unlike TFE, which is selectively degraded during heat shock .

Applications in Research

  • Transcription Assays: Reconstituted with TFB1 and RNA polymerase, recombinant TBP enables promoter-specific transcription in vitro .

  • Protein Interaction Studies: Used in pull-down assays to identify interactions with TFE and RNA polymerase subunits .

  • Mutagenesis: TBP variants with altered DNA-binding residues clarify mechanisms of promoter recognition .

Product Specs

Form
Lyophilized powder. We will ship the in-stock format unless you specify a format preference when ordering.
Lead Time
Delivery times vary by purchase method and location. Consult local distributors for specifics. All proteins ship with blue ice packs. Request dry ice in advance for an extra fee.
Notes
Avoid repeated freeze-thaw cycles. Store working aliquots at 4°C for up to one week.
Reconstitution
Briefly centrifuge the vial before opening. Reconstitute in sterile deionized water to 0.1-1.0 mg/mL. Add 5-50% glycerol (final concentration) and aliquot for long-term storage at -20°C/-80°C. Our default glycerol concentration is 50%.
Shelf Life
Shelf life depends on storage conditions, buffer, temperature, and protein stability. Liquid form: 6 months at -20°C/-80°C. Lyophilized form: 12 months at -20°C/-80°C.
Storage Condition
Store at -20°C/-80°C upon receipt. Aliquot for multiple uses. Avoid repeated freeze-thaw cycles.
Tag Info
Tag type is determined during manufacturing. If you require a specific tag, please inform us, and we will prioritize its development.
Synonyms
tbp; tfiID; SSO0951; TATA-box-binding protein; Box A-binding protein; BAP; TATA sequence-binding protein; TBP; TATA-box factor
Buffer Before Lyophilization
Tris/PBS-based buffer, 6% Trehalose.
Datasheet
Please contact us to get it.
Expression Region
1-198
Protein Length
full length protein
Purity
>85% (SDS-PAGE)
Species
Sulfolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Target Names
tbp
Target Protein Sequence
MSNSAVSYKP IVNIENIVAT VTLEQSLDLY AMERSIPNIE YDPDQFPGLI FRLEQPKVTA LIFKSGKMVV TGAKSTEELI KAVKRIIKTL KKYGIKIVGK PKIQIQNIVA SANLHVNVNL DKAAFLLENN MYEPEQFPGL IFRMDDPRVV LLIFSSGKMV ITGAKREDEV SKAVKRIFDK LAELDCVKPI EEEEELEL
Uniprot No.

Target Background

Function
This general factor activates archaeal genes transcribed by RNA polymerase. It binds specifically to the TATA box promoter element near the transcription initiation site.
Database Links

KEGG: sso:SSO0951

STRING: 273057.SSO0951

Protein Families
TBP family

Q&A

Recombinant Sulfolobus solfataricus TATA-box-binding protein (TBP) plays a critical role in archaeal transcription initiation, with structural and functional parallels to eukaryotic systems. Below are method-focused FAQs addressing key research considerations, organized by complexity and supported by experimental evidence.

What methods are used to produce and purify recombinant S. solfataricus TBP?

Recombinant TBP is typically expressed in Escherichia coli using plasmid vectors (e.g., pET28b) with an N-terminal hexahistidine tag . Post-induction with IPTG, heat treatment (80°C for 20 min) selectively denatures E. coli proteins, leaving thermostable TBP intact. Purification involves nickel-affinity chromatography followed by gel filtration to ensure homogeneity . Yield and purity are validated via SDS-PAGE and Western blotting using anti-TBP antibodies .

How is TBP’s DNA-binding activity assayed in vitro?

Electrophoretic mobility shift assays (EMSAs) are employed with synthetic oligonucleotides containing archaeal promoter A-box sequences (e.g., TATA-like motifs) . Binding reactions include:

  • 50 mM Tris-Cl (pH 7.8), 100 mM KCl, 10 mM MgCl₂

  • 1 µg poly(dI-dC) to reduce nonspecific binding

  • 10 nM fluorescein-labeled DNA probe

  • 50–200 nM recombinant TBP

Complexes are resolved on 6% native polyacrylamide gels and visualized using fluorescence imaging . Competition assays with unlabeled DNA confirm specificity.

How do TBP-TFB-TFE interactions modulate promoter specificity?

TBP alone binds A-box sequences, but transcriptional efficiency depends on协同 interactions with TFB (binds BRE element) and TFE (homolog of eukaryotic TFIIEα) . Key findings:

Promoter TypeTFE DependenceTATA-box SequenceTranscript Yield (With vs. Without TFE)
Strong (e.g., T6)NoneConsensus (TATA)1× vs. 1×
Weak (e.g., 16S)RequiredNon-consensus (G8/C1)3× vs. 1×

TFE stabilizes TBP-DNA interactions on suboptimal promoters, particularly under low TBP concentrations . Mutagenesis of the TATA-box to consensus sequences abolishes TFE dependence .

Why do some studies report TBP-independent transcription in Sulfolobus?

  • Basal transcription: RNAP retains weak promoter recognition in TBP’s absence.

  • Regulated transcription: TBP is essential for full activation, likely via DNA bending and preinitiation complex stabilization .

This duality mirrors eukaryotic systems, where TBP-independent transcription occurs at highly active promoters (e.g., rRNA genes) .

How does heat shock affect TBP function in vivo?

Under 90°C heat shock (1 hr), S. solfataricus selectively degrades TFE but not TBP or TFB . Despite a 5-fold increase in TFE mRNA, TFE protein becomes undetectable, suggesting:

  • Post-translational regulation: TFE depletion may involve stress-activated proteases or translational arrest .

  • Transcriptional adaptation: Housekeeping genes remain active without TFE, while heat shock-induced genes (e.g., cdc6-1) are upregulated independently .

How to resolve discrepancies in TBP-TFB-TFE stoichiometry across studies?

Variations arise from:

  • Promoter context: Strong promoters (e.g., viral T6) require only TBP-TFB, while weak promoters (e.g., 16S) need TFE for stabilization .

  • Buffer conditions: High TBP concentrations (≥200 nM) mask TFE’s stimulatory effect .

  • RNAP purity: Endogenous TFE in RNAP preparations may confound in vitro assays .

Solution: Standardize reaction conditions (e.g., 50 nM TBP, 25 nM TFB, 10 nM RNAP) and verify TFE contamination via Western blotting .

What controls are critical for in vitro transcription assays?

  • Negative controls: Omit TBP or use A-box mutants (e.g., TATA→GATA) .

  • Competitor DNA: Include unlabeled A-box DNA to confirm specificity .

  • Heat-inactivated RNAP: Rule out nonspecific RNA synthesis .

How to validate TBP’s role in a genetic system?

CRISPR-interference (CRISPRi) can knockdown tbp in Sulfolobus . Measure:

  • Growth curves under optimal (75°C) vs. stress (90°C) conditions .

  • RNA-seq profiles to identify TBP-dependent genes (e.g., ribosomal vs. heat shock) .

Quick Inquiry

Personal Email Detected
Please use an institutional or corporate email address for inquiries. Personal email accounts ( such as Gmail, Yahoo, and Outlook) are not accepted. *
© Copyright 2025 TheBiotek. All Rights Reserved.