Recombinant Treponema denticola 50S ribosomal protein L16 (rplP)

What is the basic structure and function of T. denticola rplP?

T. denticola 50S ribosomal protein L16 (rplP) is a 139 amino acid protein with a molecular mass of approximately 15.6 kDa. It belongs to the universal ribosomal protein uL16 family. The protein functions by binding to 23S rRNA and making contacts with the A and possibly P site tRNAs . As a component of the 50S ribosomal subunit, it plays a critical role in the peptidyltransferase center and protein synthesis machinery of T. denticola.

How does the amino acid sequence of T. denticola rplP compare with homologous proteins in other bacterial species?

The amino acid sequence of T. denticola rplP shows conservation patterns typical of ribosomal proteins, with distinct differences from related species:

The comparison reveals highly conserved regions involved in rRNA binding and ribosomal function, particularly in the central domain, while showing species-specific variations .

What are the recommended expression systems for producing recombinant T. denticola rplP?

For optimal expression of recombinant T. denticola rplP, E. coli-based expression systems are generally recommended. The methodology involves:

• Vector selection: pET expression vectors with T7 promoter systems work effectively for ribosomal proteins.

• Host strain: BL21(DE3) or Rosetta strains address potential codon bias issues, as T. denticola has different codon usage patterns compared to E. coli.

• Induction conditions: IPTG induction at lower temperatures (16-25°C) helps reduce inclusion body formation.

• Codon optimization: Adjusting the T. denticola rplP sequence for E. coli expression systems can improve yield significantly.

Alternatively, cell-free protein synthesis may be employed when potential toxicity of overexpressed ribosomal proteins affects host cell viability .

What purification strategy yields the highest purity of functional recombinant T. denticola rplP?

A multi-step purification approach produces the highest purity functional protein:

• Affinity chromatography: His-tagged rplP purification using Ni-NTA resin (optimal with C-terminal tag to avoid interfering with N-terminal rRNA binding)

• Ion exchange chromatography: Using SP-Sepharose at pH 7.0 (as rplP has a calculated pI of approximately 10.5)

• Size exclusion chromatography: Final polishing step using Superdex 75 column

For functional studies requiring native conformation:

• Include RNase inhibitors throughout purification

• Maintain reducing conditions (1-5 mM DTT or 2-10 mM β-mercaptoethanol)

• Verify RNA-binding activity using gel shift assays with 23S rRNA fragments

Typical yields range from 5-10 mg per liter of E. coli culture under optimized conditions .

How can researchers efficiently design primers for amplification and cloning of T. denticola rplP?

For successful amplification and cloning of T. denticola rplP, researchers should follow these methodological approaches:

• Primer design strategy:

  • Forward primer: Include 5-10 nucleotide overhang, restriction site, and 18-25 nucleotides complementary to the 5′ end of the rplP gene

  • Reverse primer: Include stop codon (if needed), restriction site, and 18-25 nucleotides complementary to the 3′ end

  • Consider GC content (45-60%) and avoid secondary structures

• Recommended PCR conditions:

  • Initial denaturation: 95°C for 2 minutes

  • 35-40 cycles: 95°C for 30 seconds, 55-58°C for 30 seconds, 72°C for 1 minute

  • Final extension: 72°C for 5 minutes

• Gene-specific considerations:

  • T. denticola has a low GC content (approximately 37-38%), necessitating careful primer design

  • Use 16S rRNA universal primers (AGAGTTTGATCMTGGCTCAG and ACCGCGGCTGCTGGCAC) as positive controls for DNA quality

  • For T. denticola-specific amplification, combine with species-specific primers like those targeting 16S rRNA: TAATACCGTATGTGCTCATTTACAT and TCAAAGAAGCATTCCCTCTTCTTCTTA

What methods are most effective for analyzing rplP interactions with rRNA and tRNAs?

To effectively analyze rplP interactions with rRNA and tRNAs, researchers should employ multiple complementary approaches:

• RNA binding assays:

  • Electrophoretic mobility shift assays (EMSA) with purified recombinant rplP and labeled 23S rRNA fragments

  • Filter binding assays for quantitative binding kinetics determination

• Structural analysis methods:

  • Cryo-electron microscopy of reconstituted ribosomal subunits containing recombinant rplP

  • Chemical crosslinking followed by mass spectrometry to identify amino acid residues in direct contact with RNA

  • Hydroxyl radical footprinting to map rplP binding sites on 23S rRNA

• Mutagenesis approach:

  • Alanine scanning mutagenesis of predicted RNA-binding residues

  • Creation of chimeric proteins using homologous regions from related bacteria (e.g., T. pallidum rplP) to identify functionally important domains

• In vitro translation assays:

  • Reconstitution of 50S subunits with wild-type or mutant rplP

  • Measurement of peptidyltransferase activity to correlate structural interactions with functional outcomes

How does T. denticola rplP compare functionally with homologous proteins from other oral pathogens?

Functional comparison of T. denticola rplP with homologous proteins from other oral pathogens reveals important evolutionary and structural insights:

• Functional conservation:

  • Core functions in rRNA binding and ribosome assembly are highly conserved across oral pathogens

  • The central domain involved in peptidyltransferase center formation shows >80% sequence identity across treponemes

• Structural variations:

  • T. denticola rplP has unique surface-exposed regions compared to other oral spirochetes

  • These regions may interact with species-specific accessory proteins or represent adaptation to the periodontal environment

• Evolutionary implications:

  • Phylogenetic analysis based on rplP sequences corresponds with the established evolutionary relationships determined through multilocus sequence analysis (MLSA)

  • The pattern of conservation suggests stronger selective pressure on ribosomal proteins compared to other cellular components

The high conservation of rplP across Treponema species (including both oral and systemic pathogens) provides potential targets for broad-spectrum antimicrobial development while species-specific regions may offer opportunities for diagnostic differentiation .

What insights can be gained from comparing rplP across different T. denticola strains?

Comparative analysis of rplP across T. denticola strains provides valuable insights into strain diversity and evolution:

• Sequence conservation patterns:

  • Core functional domains show >95% sequence identity across clinical isolates

  • Variations primarily occur in surface-exposed regions, suggesting potential immune selection

• Strain classification:

  • rplP sequence analysis complements established multilocus sequence analysis (MLSA) approaches

  • The gene exhibits lower polymorphism rates (estimated 8-10%) compared to virulence-associated genes (like flaA with 18.8% polymorphism)

• Geographical distribution analysis:

  • No clear geographical clustering based solely on rplP sequences

  • Strains isolated from different continents can be closely related genetically, suggesting global dissemination of certain lineages

• Methodological approach:

  • PCR amplification using conserved flanking primers

  • Direct sequencing of amplicons to identify single nucleotide polymorphisms

  • Phylogenetic tree construction using maximum likelihood and Bayesian methods

This comparative approach can help resolve relationships between the six major clades of T. denticola identified through comprehensive MLSA studies .

What are the common challenges in expressing recombinant T. denticola rplP and how can they be overcome?

Researchers frequently encounter several technical challenges when expressing recombinant T. denticola rplP. Here are methodological solutions to address these issues:

• Low expression levels:

  • Challenge: T. denticola's low GC content (~38%) can lead to codon usage incompatibility in E. coli

  • Solution: Use codon-optimized synthetic genes or Rosetta strains containing rare tRNA genes. Expression in Rosetta(DE3)pLysS has shown 2-3 fold improvement over standard BL21(DE3) strains.

• Protein aggregation/inclusion bodies:

  • Challenge: rplP tends to form inclusion bodies at high expression levels

  • Solution: Lower induction temperature (16-20°C), reduce IPTG concentration (0.1-0.3 mM), and co-express with chaperones (GroEL/GroES system). Including 5-10% glycerol in lysis buffer can improve solubility.

• RNA contamination:

  • Challenge: Native RNA-binding activity of rplP results in co-purification with host RNA

  • Solution: Include high salt washes (0.8-1.0 M NaCl) during purification and treat with RNase A (10-50 μg/ml) before final chromatography steps.

• Protein instability:

  • Challenge: Purified rplP can show degradation during storage

  • Solution: Store at -80°C in buffer containing 50 mM Tris-HCl pH 7.5, 300 mM NaCl, 1 mM DTT, and 10% glycerol. Adding protease inhibitors during purification is essential.

• Functional verification:

  • Challenge: Confirming that recombinant protein retains native RNA-binding properties

  • Solution: Perform RNA gel-shift assays with synthetic 23S rRNA fragments containing the known binding regions.

How can researchers distinguish between experimental artifacts and genuine results when studying rplP-RNA interactions?

When studying rplP-RNA interactions, distinguishing between artifacts and genuine results requires rigorous experimental design and appropriate controls:

• Negative control strategy:

  • Use structurally similar but functionally distinct ribosomal proteins (e.g., L15 or L17)

  • Test binding to non-target RNA sequences

  • Include heat-denatured rplP samples to control for non-specific interactions

• Validation through multiple methodologies:

  • Confirm interactions observed in EMSAs with filter binding assays

  • Corroborate binding data with chemical crosslinking results

  • Use isothermal titration calorimetry to obtain independent binding parameters

• Artifact identification checklist:

  • RNA degradation: Run RNA integrity controls on gels

  • Protein aggregation: Perform dynamic light scattering before interaction studies

  • Buffer/salt effects: Test interactions across various ionic conditions (150-500 mM KCl)

• Concentration considerations:

  • Use physiologically relevant protein:RNA ratios

  • Perform titration experiments to determine saturation points

  • Account for potential cooperative binding effects

• Computational validation:

  • Compare experimental results with structural predictions

  • Use homology modeling based on known ribosomal crystal structures to predict and verify binding interfaces

How can recombinant T. denticola rplP be used to investigate virulence mechanisms in periodontal disease?

Recombinant T. denticola rplP offers several sophisticated approaches to investigate virulence mechanisms in periodontal disease:

• Immunological studies:

  • Generate anti-rplP antibodies to track T. denticola in polymicrobial biofilms

  • Examine potential cross-reactivity between rplP and host proteins, which may contribute to autoimmune aspects of periodontal disease

  • Investigate whether rplP is exposed or released during infection, potentially serving as a pathogen-associated molecular pattern (PAMP)

• Comparative proteomics approach:

  • Use recombinant rplP as a standard in quantitative proteomic analyses

  • Compare expression levels across T. denticola strains with different virulence potential

  • Correlate rplP expression with other virulence factors like dentilisin and major surface protein (Msp)

• Host-pathogen interaction models:

  • Examine effects of exogenous rplP on host cells like periodontal ligament fibroblasts

  • Investigate potential TLR2/MyD88 pathway activation, similar to other T. denticola components

  • Test if rplP contributes to immune evasion mechanisms

• Translational stalling investigation:

  • Examine whether T. denticola modulates translation of specific host genes through interactions between rplP and host ribosomes

  • Compare with known ribosome-targeting bacterial virulence mechanisms

• Diagnostic marker development:

  • Evaluate rplP as a potential biomarker for active T. denticola infection

  • Develop detection methods for tracking T. denticola in clinical samples from periodontal lesions

What are the potential applications of using T. denticola rplP in structure-based drug design for periodontal disease?

Structure-based drug design targeting T. denticola rplP presents a promising frontier in periodontal disease therapeutics:

• Target validation approach:

  • Validate rplP essentiality through gene knockdown/knockout studies

  • Identify species-specific structural features of T. denticola rplP not present in human ribosomes

  • Perform molecular dynamics simulations to identify druggable pockets unique to bacterial rplP

• Inhibitor design strategy:

  • Focus on regions that differ between human and bacterial ribosomal proteins

  • Design compounds that specifically disrupt rplP-23S rRNA interactions

  • Develop peptide mimetics based on known antibiotic binding sites in the peptidyltransferase center

• Methodological workflow:

  • Obtain high-resolution structure through X-ray crystallography or cryo-EM

  • Perform in silico screening against compound libraries

  • Validate hits through binding assays and functional inhibition tests

  • Assess specificity using mammalian ribosomal translation systems

• Practical considerations:

  • Design compounds with appropriate pharmacokinetics for the periodontal pocket environment

  • Consider local delivery mechanisms (gels, films, microspheres)

  • Evaluate potential for resistance development through mutation of the target

• Combination therapeutic approach:

  • Test synergy between rplP inhibitors and established antimicrobials

  • Explore combinations with inhibitors of other virulence factors like dentilisin

  • Investigate potential for biofilm disruption through combined targeting of structural and functional proteins

How can genomic and transcriptomic approaches be integrated with recombinant rplP studies to better understand T. denticola biology?

Integration of genomic and transcriptomic approaches with recombinant rplP studies provides comprehensive insights into T. denticola biology:

• Multi-omics experimental design:

  • Compare rplP expression levels across different growth conditions and strain types

  • Correlate rplP expression with global transcriptomic changes during stress responses

  • Investigate potential regulatory roles beyond translation

• Technical implementation:

  • Use RNA-Seq to determine expression patterns under various conditions

  • Apply ribosome profiling to examine translational regulation

  • Employ ChIP-Seq with anti-rplP antibodies to identify potential non-canonical interactions with DNA

• Methodological workflow for co-expression analysis:

  • Generate RNA-Seq data from T. denticola under various conditions

  • Identify genes co-expressed with rplP using weighted gene co-expression network analysis

  • Validate key interactions using recombinant proteins and in vitro assays

• Integration with structural biology:

  • Use recombinant rplP in structural studies of the T. denticola ribosome

  • Compare with whole-cell cryo-electron tomography to place findings in cellular context

  • Correlate structural variations with functional differences between strains

• Application to strain typing and epidemiology:

  • Develop rplP sequence analysis as a component of multilocus sequence typing

  • Compare with established typing methods based on 16S rRNA and housekeeping genes

  • Investigate correlations between rplP sequence variations and clinical outcomes

This integrated approach allows researchers to place rplP function within the broader context of T. denticola cellular processes and periodontal disease pathogenesis.

What emerging technologies might enhance our understanding of T. denticola rplP function and applications?

Several cutting-edge technologies show promise for advancing T. denticola rplP research:

• Cryo-electron microscopy applications:

  • Single-particle analysis of T. denticola ribosomes with native or modified rplP

  • Visualization of conformational changes during translation

  • Structure determination at near-atomic resolution to guide drug design

• CRISPR-Cas9 genome editing in spirochetes:

  • Development of inducible knockdown/knockout systems for rplP

  • Creation of point mutations to test structure-function hypotheses

  • Engineering of fluorescently tagged rplP for localization studies

• Advanced mass spectrometry approaches:

  • Hydrogen-deuterium exchange mass spectrometry to map protein-RNA interaction surfaces

  • Crosslinking mass spectrometry to identify interaction partners within the ribosome

  • Top-down proteomics to characterize post-translational modifications

• Microfluidics and single-cell analysis:

  • Investigation of rplP expression heterogeneity in T. denticola populations

  • Real-time monitoring of translation in microfluidic chambers

  • Single-cell proteomics to correlate rplP levels with other virulence factors

• Synthetic biology applications:

  • Creation of chimeric ribosomes with engineered rplP variants

  • Development of T. denticola-specific translational reporters

  • Engineering of orthogonal translation systems for antibiotic development

How might understanding T. denticola rplP contribute to broader research on microbial communities in oral disease?

Research on T. denticola rplP has significant implications for understanding polymicrobial interactions in oral disease:

• Microbial community interaction studies:

  • Investigate differential rplP expression in mono-culture versus polymicrobial communities

  • Examine potential horizontal gene transfer of ribosomal protein variants

  • Study metabolic interactions through selective inhibition of T. denticola translation

• Methodological approaches:

  • Apply metaproteomics to detect and quantify rplP in clinical samples

  • Use antibodies against species-specific rplP epitopes for immunohistochemistry of biofilms

  • Develop rplP-based methods for microbial source tracking in oral infections

• Translational research implications:

  • Target rplP to specifically inhibit T. denticola without disrupting beneficial microbiota

  • Develop diagnostic tools based on detection of rplP transcripts or proteins

  • Create vaccines targeting surface-exposed epitopes of rplP if identified

• Integration with periodontal disease modeling:

  • Correlate T. denticola rplP expression with disease progression in animal models

  • Examine potential connections with systemic disease through detection of rplP in atherosclerotic lesions

  • Investigate interactions between T. denticola and host immune response mediated by ribosomal proteins

• One Health approach:

  • Compare rplP from human oral T. denticola with related spirochetes found in animal reservoirs

  • Investigate potential zoonotic transmission through comparative genomics

  • Study coevolution of ribosomal components in host-associated microbiomes

This broader understanding will contribute to developing more targeted and effective interventions for periodontal disease and potentially related systemic conditions.