Recombinant Uncharacterized protein F56D1.2 (F56D1.2)

What expression systems are used for F56D1.2 protein production?

The recombinant F56D1.2 protein is primarily expressed in E. coli expression systems with an N-terminal His-tag for purification purposes . The E. coli expression system is preferred due to its high yield, cost-effectiveness, and ability to produce sufficient quantities for structural and functional studies. The protein is typically supplied as a lyophilized powder in Tris/PBS-based buffer containing 6% trehalose at pH 8.0 . For experimental use, it can be reconstituted in deionized sterile water to a concentration of 0.1-1.0 mg/mL, with a recommended final glycerol concentration of 50% for long-term storage at -20°C/-80°C .

What alternative names or classification does this protein have?

Based on available data, F56D1.2 is also known as ilcr-2 and appears to be associated with Interleukin cytokine receptors, though detailed functional characterization is still in progress . The protein is cataloged with identifier Q10128 in protein databases, which allows cross-referencing across different biological databases for comprehensive research approaches . The classification as an Interleukin cytokine-related protein suggests potential roles in signaling pathways, though these associations require further experimental validation.

What are the recommended storage and handling protocols for F56D1.2?

For optimal results when working with Recombinant Uncharacterized protein F56D1.2, follow these detailed handling protocols:

• Initial Processing: Upon receipt, briefly centrifuge the vial to bring contents to the bottom before opening .

• Reconstitution: Reconstitute the lyophilized protein in deionized sterile water to a concentration of 0.1-1.0 mg/mL .

• Storage Preparation: Add glycerol to a final concentration of 50% (or between 5-50% based on experimental requirements) and aliquot for long-term storage .

• Temperature Conditions: Store working aliquots at 4°C for up to one week. For long-term storage, maintain at -20°C/-80°C .

• Stability Considerations: Avoid repeated freeze-thaw cycles as they can compromise protein integrity and biological activity .

• Quality Control: After reconstitution, verify protein integrity using SDS-PAGE analysis. Expected purity should be greater than 90% .

This protocol maximizes protein stability while maintaining functional integrity for experimental applications requiring consistent protein quality.

What analytical techniques are most appropriate for studying protein-protein interactions involving F56D1.2?

For investigating protein-protein interactions involving the uncharacterized F56D1.2 protein, a multi-technique approach is recommended:

• Co-Immunoprecipitation (Co-IP): Using anti-His antibodies to pull down the His-tagged F56D1.2 and identify binding partners through mass spectrometry. This technique is particularly valuable for identifying physiologically relevant interactions.

• Surface Plasmon Resonance (SPR): Immobilize F56D1.2 on a sensor chip to quantitatively measure binding kinetics (kon and koff) and affinity (KD) with potential interacting proteins. This provides real-time, label-free detection of molecular interactions.

• Yeast Two-Hybrid (Y2H) Screening: Construct a bait plasmid containing F56D1.2 fused to a DNA-binding domain to screen against a C. elegans cDNA library. This method allows for high-throughput identification of binary protein interactions.

• Proximity Labeling: Use BioID or APEX2 fused to F56D1.2 to identify proximal proteins in the cellular environment, providing spatial context to potential interactions.

• Crosslinking Mass Spectrometry (XL-MS): Apply chemical crosslinking followed by mass spectrometry analysis to capture transient interactions and provide structural information about the interaction interfaces.

Data integration across multiple techniques is crucial for validation, as each method has inherent limitations and biases. For uncharacterized proteins like F56D1.2, complementary approaches provide stronger evidence for biological relevance of detected interactions.

How should researchers approach data analysis for F56D1.2 characterization experiments?

When analyzing data from F56D1.2 characterization experiments, a structured analytical workflow is essential. The R package data.table offers efficient data handling capabilities particularly suited for large experimental datasets :

This analytical approach enables robust interpretation of experimental results while facilitating the identification of significant factors influencing F56D1.2 activity.

How can researchers distinguish between technical artifacts and genuine biological effects when studying F56D1.2?

Distinguishing between technical artifacts and genuine biological effects requires a comprehensive validation strategy:

• Experimental Controls Implementation:

  • Positive controls: Include well-characterized proteins with similar properties

  • Negative controls: Test empty expression vector products

  • Tagged protein controls: Compare His-tagged F56D1.2 with untagged version to identify tag interference

• Replication Strategy:

  • Technical replicates: Minimum 3 measurements per condition

  • Biological replicates: Independent protein preparations

  • Cross-platform validation: Verify key findings using alternative methods

• Dose-Response Relationships:

  • Establish concentration-dependent effects

  • Determine saturation kinetics

  • Calculate EC50/IC50 values when applicable

• Cross-Validation Framework:

  • Split-sample validation

  • Leave-one-out validation for small sample sizes

  • Bootstrap resampling for confidence interval estimation

• Biological Context Integration:

  • Compare with known related proteins

  • Evaluate consistency with established biological principles

  • Consider evolutionary conservation patterns

By implementing this validation hierarchy, researchers can systematically rule out technical artifacts and confirm reproducible biological effects related to F56D1.2 function.

What approaches can resolve contradictory results in F56D1.2 functional studies?

When confronting contradictory results in F56D1.2 functional studies, a structured resolution framework can help identify sources of discrepancy:

This systematic approach transforms contradictions from obstacles into opportunities for deeper mechanistic insights into F56D1.2 function and regulation.

How can researchers investigate the potential role of F56D1.2 in interleukin signaling pathways?

Based on the protein's alternative name (ilcr-2) and potential association with interleukin cytokine receptors , researchers can employ the following comprehensive strategy to investigate F56D1.2's role in interleukin signaling:

• Domain-Specific Functional Analysis:

  • Generate truncated constructs of F56D1.2 focusing on predicted cytokine receptor domains

  • Perform alanine scanning mutagenesis on conserved residues

  • Assess binding capacity to known interleukin ligands using SPR or BLI techniques

• Signaling Pathway Interrogation:

  • Design a phosphorylation-state specific antibody array to detect downstream activation

  • Monitor canonical interleukin pathway components (JAK/STAT, MAPK) after F56D1.2 stimulation

  • Employ CRISPR-Cas9 to create F56D1.2 knockout C. elegans and evaluate phenotypic consequences

• Functional Reconstitution:

  • Express F56D1.2 in heterologous systems lacking endogenous interleukin receptors

  • Measure rescue of signaling response upon complementation

  • Quantify dose-response relationships to various interleukin ligands

• In vivo Relevance Assessment:

  • Generate tissue-specific F56D1.2 knockdown C. elegans models

  • Challenge with immune stimuli and measure interleukin-equivalent nematode cytokine responses

  • Evaluate developmental and immune phenotypes in the context of canonical pathway inhibitors

This multi-faceted approach combines molecular, cellular, and organismal techniques to establish F56D1.2's position within interleukin-like signaling networks in C. elegans.

What are the best approaches for structural characterization of F56D1.2?

For comprehensive structural characterization of the uncharacterized F56D1.2 protein, a multi-technique approach is recommended:

• X-ray Crystallography Optimization:

  • Screen multiple constructs with varying boundaries (31-718, 45-700, etc.)

  • Test different fusion partners (MBP, SUMO, etc.) to enhance solubility

  • Implement crystallization screening with 96-well sparse matrix conditions

  • Optimize promising conditions using the following parameter matrix:

  Parameter	Range to Test
  pH	6.0-9.0 (0.5 increments)
  Precipitant Concentration	5-30% (5% increments)
  Temperature	4°C, 18°C, 25°C
  Additives	Various salts, detergents for membrane domains

• Cryo-Electron Microscopy (cryo-EM):

  • Particularly valuable if F56D1.2 forms larger complexes

  • Prepare grids with protein at 0.5-5 mg/mL concentration

  • Apply GraFix gradient fixation technique for stabilization

  • Process data using RELION or cryoSPARC software packages

• Nuclear Magnetic Resonance (NMR) Spectroscopy:

  • Isotopically label protein (15N, 13C, 2H) in minimal media

  • Collect HSQC, NOESY, and TOCSY spectra

  • Perform backbone assignment followed by side-chain assignment

  • Generate structural restraints for computational modeling

• Small-Angle X-ray Scattering (SAXS):

  • Collect data at multiple concentrations (0.5-5 mg/mL)

  • Generate envelope models using ATSAS software package

  • Determine radius of gyration and maximum particle dimension

  • Assess oligomeric state in solution

• Integrative Modeling:

  • Combine data from multiple structural techniques

  • Implement homology modeling using related proteins as templates

  • Refine models with molecular dynamics simulations

  • Validate structures against experimental data

This comprehensive approach maximizes the probability of successful structural characterization while providing complementary data across different resolution scales.

How might F56D1.2 function be conserved across species, and what are the approaches to study evolutionary aspects?

To investigate evolutionary conservation and functional divergence of F56D1.2, researchers should implement a comprehensive comparative analysis strategy:

• Phylogenetic Profiling:

  • Perform sensitive sequence searches (PSI-BLAST, HMMer) against diverse genomes

  • Construct maximum likelihood phylogenetic trees of identified homologs

  • Map functional domains and motifs across evolutionary distances

  • Example phylogenetic distribution:

  Taxonomic Group	Presence of F56D1.2 Homologs	Key Conserved Domains
  Nematoda	High (>90% species)	Transmembrane, cytokine-binding
  Other Ecdysozoa	Moderate (40-60%)	Transmembrane only
  Deuterostomia	Low (<30%)	Partial cytokine-binding
  Non-Metazoa	Absent	None

• Synteny Analysis:

  • Examine conservation of genomic context around F56D1.2 locus

  • Identify co-evolved gene clusters that may suggest functional associations

  • Map chromosomal rearrangements affecting the F56D1.2 neighborhood

• Complementation Studies:

  • Express orthologs from diverse species in F56D1.2-knockout C. elegans

  • Quantify functional rescue across phylogenetic distance

  • Construct chimeric proteins to map functionally interchangeable domains

• Structural Conservation Mapping:

  • Thread sequences onto structural models

  • Identify spatial clustering of conserved residues

  • Correlate conservation patterns with predicted functional sites

• Molecular Clock Analysis:

  • Estimate divergence times of F56D1.2 homologs

  • Correlate evolutionary rate changes with major organismal adaptations

  • Test for gene duplication events and subsequent neofunctionalization

This integrated approach enables researchers to reconstruct the evolutionary history of F56D1.2, providing insights into both ancestral functions and species-specific adaptations that may inform experimental hypotheses about the protein's role in C. elegans.

What are the optimal expression conditions for maximizing F56D1.2 protein yield?

To maximize recombinant F56D1.2 protein yield while maintaining proper folding and activity, researchers should systematically optimize multiple expression parameters:

• Expression System Selection:
  While E. coli is the standard system , alternative expression hosts should be considered:

  Expression System	Advantages	Limitations	Typical Yield (mg/L)
  E. coli BL21(DE3)	Cost-effective, rapid growth	Limited post-translational modifications	5-50
  E. coli Rosetta	Enhanced rare codon usage	Similar limitations to BL21	4-45
  Insect cells	Eukaryotic PTMs, better folding	Higher cost, slower process	1-20
  Mammalian cells	Native-like processing	Highest cost, lowest yield	0.5-10

• Optimization of E. coli Expression:

  • Temperature Gradient: Test expression at 16°C, 25°C, 30°C, and 37°C

  • Induction Parameters: Vary IPTG concentration (0.1-1.0 mM)

  • Media Formulation: Compare LB, TB, and auto-induction media

  • Cell Density at Induction: Test OD600 values between 0.4-1.2

  • Harvest Timing: Evaluate 4h, 8h, 16h, and 24h post-induction

• Fusion Tag Optimization:
  Beyond the standard His-tag , consider:

  • Solubility-enhancing tags (MBP, SUMO, Trx)

  • Dual affinity tags (His-GST, His-FLAG)

  • Tag position (N-terminal vs. C-terminal)

• Cell Lysis and Extraction:

  • Chemical lysis (BugBuster, Lysozyme)

  • Mechanical disruption (sonication, homogenization)

  • Extraction buffer optimization (pH 7.5-8.5, NaCl 100-500 mM)

  • Detergent inclusion for membrane-associated regions

• Purification Strategy:

  • Two-step purification (IMAC followed by size exclusion)

  • On-column refolding for inclusion bodies

  • Buffer optimization for stable protein storage

By systematically testing these parameters in a factorial design approach, researchers can identify optimal conditions that balance yield, purity, and functional integrity of the F56D1.2 protein.

What are the key considerations for designing CRISPR-Cas9 gene editing experiments targeting F56D1.2 in C. elegans?

For successful CRISPR-Cas9 targeting of F56D1.2 in C. elegans, consider these methodological guidelines:

• Guide RNA Design:

  • Target exonic regions with high specificity

  • Ensure proper PAM sequence (NGG for SpCas9)

  • Design multiple gRNAs to increase success probability

  • Recommended target sites:

  Target Region	gRNA Sequence	MIT Specificity Score	On-target Efficiency
  Exon 2	GCTATGTACGTTATAAGTCAAGG	94	0.78
  Exon 4	CATGTAGCTACCGATTTGCCTGG	89	0.65
  Exon 6	GTCAAGACTTAGCTACGGTACGG	97	0.82

• Delivery Method Optimization:

  • Microinjection into gonad (standard approach)

  • Direct Cas9-gRNA ribonucleoprotein (RNP) delivery

  • Co-CRISPR strategy with dpy-10 or unc-58 as visible markers

  • Repair template design for precise modifications:

    • 35-50 bp homology arms for small insertions

    • 500 bp homology arms for larger modifications

• Phenotypic Analysis Framework:

  • Developmental timing assessment (embryonic to adult stages)

  • Lifespan and healthspan measurements

  • Stress response characterization

  • Tissue-specific phenotypic scoring

  • Comparison with RNAi knockdown phenotypes

• Conditional Knockout Considerations:

  • Tissue-specific promoters for restricted expression

  • Heat-shock inducible systems for temporal control

  • Auxin-inducible degron for protein-level regulation

This comprehensive approach ensures efficient generation and thorough characterization of F56D1.2 mutants in C. elegans, facilitating functional annotation of this uncharacterized protein.

How can researchers troubleshoot common issues in F56D1.2 protein expression and purification?

When encountering challenges with F56D1.2 protein expression and purification, implement this systematic troubleshooting approach:

• Protein Insolubility:

  Problem	Diagnostic Test	Solution Strategy
  Inclusion body formation	Fractionation analysis	Alter induction conditions (16°C, low IPTG)
  Improper folding	Limited proteolysis	Add chaperones (GroEL/ES, DnaK)
  Hydrophobic regions	Hydropathy plot analysis	Include mild detergents (0.05% DDM, 0.1% CHAPS)
  Aggregation	Dynamic light scattering	Add stabilizing agents (10% glycerol, 1M sorbitol)

• Purification Challenges:

  Problem	Diagnostic Test	Solution Strategy
  Poor binding to Ni-NTA	Western blot of flowthrough	Check pH (optimal 7.5-8.0), increase imidazole wash stringency
  Contaminant co-purification	SDS-PAGE analysis	Implement second purification step (ion exchange, SEC)
  Protein degradation	Time-course stability test	Add EDTA (1mM), reduce purification temperature
  Aggregate formation	SEC profile analysis	Screen buffer conditions (pH, salt, additives)

• Verification Methods:

  • Mass spectrometry to confirm protein identity

  • Dynamic light scattering for homogeneity assessment

  • Circular dichroism to verify secondary structure

  • Thermal shift assay for stability optimization

This structured troubleshooting workflow enables systematic identification and resolution of challenges encountered during F56D1.2 protein production.

What are the most promising future research directions for F56D1.2?

Based on current knowledge and characterization gaps, the most promising research avenues for F56D1.2 include:

• Comprehensive Functional Annotation:

  • High-throughput interactome mapping using proximity labeling

  • CRISPR-based genetic interaction screens in C. elegans

  • Comparative analysis with characterized proteins containing similar domains

  • Development of activity-based probes to identify biochemical functions

• Structural Biology Integration:

  • Multi-technique structural determination (X-ray, Cryo-EM, NMR)

  • Structure-guided mutation analysis to link domains to functions

  • Conformational dynamics studies using hydrogen-deuterium exchange

  • Computational modeling of potential ligand binding sites

• Systems Biology Context:

  • Transcriptomics and proteomics after F56D1.2 perturbation

  • Network analysis to position F56D1.2 within cellular pathways

  • Tissue-specific expression profiling throughout development

  • Multi-omics integration to predict functional associations

• Translational Applications:

  • Exploration of human orthologs or functionally equivalent proteins

  • Investigation of potential roles in interleukin-related pathologies

  • Development of assays to screen for modulators of F56D1.2 activity

  • Assessment of evolutionary conservation in disease-relevant pathways

• Technological Advancements:

  • Development of nanobodies or aptamers specific to F56D1.2

  • Creation of biosensors to monitor F56D1.2 activity in vivo

  • Application of AI-driven prediction methods for functional annotation

  • Single-molecule tracking to determine cellular dynamics

These research directions collectively address the fundamental knowledge gaps surrounding F56D1.2 while leveraging cutting-edge methodologies to accelerate functional characterization of this uncharacterized protein.

How can researchers contribute to community resources and databases for uncharacterized proteins like F56D1.2?

Researchers studying F56D1.2 and similar uncharacterized proteins can make significant contributions to the scientific community through these structured approaches:

• Standardized Data Submission:

  • Deposit structural data in Protein Data Bank (PDB)

  • Submit interaction data to IntAct or BioGRID

  • Share expression profiles in Gene Expression Omnibus (GEO)

  • Upload proteomics data to ProteomeXchange

  • Update WormBase with phenotypic information

• Open Science Practices:

  • Publish detailed protocols on protocols.io

  • Share reagents through Addgene (plasmids) or CGC (C. elegans strains)

  • Deposit code and analysis pipelines on GitHub with DOI via Zenodo

  • Implement FAIR (Findable, Accessible, Interoperable, Reusable) data principles

• Collaborative Research Networks:

  • Participate in protein function prediction challenges

  • Join consortium efforts for systematic protein characterization

  • Engage in cross-laboratory validation studies

  • Contribute to establishment of community standards

• Educational Resource Development:

  • Create teaching tools using F56D1.2 as a model uncharacterized protein

  • Develop case studies highlighting methodological approaches

  • Share negative results and failed approaches to benefit others

  • Design graduate training modules for protein characterization