Recombinant Uncharacterized protein Rv2075c/MT2135 (Rv2075c, MT2135)

What expression systems are suitable for producing recombinant Rv2075c/MT2135?

Several expression systems have been employed for producing recombinant mycobacterial proteins, with varying advantages depending on research objectives:

For Rv2075c/MT2135 specifically, E. coli has been successfully used as a host for producing His-tagged full-length protein (1-487 amino acids) . When selecting an expression system, consider the downstream applications and whether post-translational modifications are critical for your research questions.

How can researchers confirm the identity of recombinant Rv2075c/MT2135?

Identity confirmation of recombinant Rv2075c/MT2135 requires multiple complementary analytical approaches:

• SDS-PAGE and Western Blotting:

  • Molecular weight verification (expected ~54 kDa for the native protein)

  • Antibody detection using anti-His antibodies for tagged variants

• Mass Spectrometry Techniques:

  • Shotgun MS for qualitative assessment

  • Selected Reaction Monitoring (SRM) for targeted validation

  • Data-dependent acquisition using Q-Exactive mass spectrometry

• Peptide Fingerprinting:

  • Tryptic digest followed by LC-MS/MS

  • Database matching against known M. tuberculosis proteome databases

• PCR Verification:

  • Using RD9-specific primers such as RD9-intF (CGATGGTCAACACCACTACG) and RD9-intR (CTGGACCTCGATGACCACTC) to confirm the gene's presence

Mass spectrometry approaches are particularly valuable, as they can verify the sequence with high confidence and identify any post-translational modifications that may be present.

What experimental designs are most effective for studying the function of uncharacterized proteins like Rv2075c/MT2135?

When investigating uncharacterized proteins like Rv2075c/MT2135, systematic experimental designs with appropriate controls are essential. Single-subject experimental designs offer particular advantages for microbial protein characterization:

• Reversal Designs (A-B-A):

  • Baseline measurements of bacterial growth/phenotype (A)

  • Introduction of recombinant Rv2075c/MT2135 (B)

  • Return to baseline conditions (A)

  • Provides powerful demonstration of functional relationships between protein presence and phenotypic changes

• Multiple Baseline Designs:

  • Implementation of Rv2075c/MT2135 expression staggered across different bacterial strains, growth conditions, or cellular compartments

  • Allows assessment of protein function without requiring withdrawal of the protein

• Multielement Designs:

  • Rapidly alternating conditions to compare wild-type Rv2075c/MT2135 with mutated variants

  • Useful for structure-function relationship studies

  • Can identify optimal experimental conditions quickly

• Comparative Analysis Approaches:

  • Comparing expression and function between pathogenic and non-pathogenic mycobacterial strains

  • Correlating Rv2075c/MT2135 expression levels with clinical isolate virulence patterns

When designing experiments, researchers should consider internal validity (ensuring observed changes are due to Rv2075c/MT2135 and not confounding variables) and external validity (determining whether findings apply across different mycobacterial strains and environmental conditions) .

How can researchers utilize proteomics approaches to characterize Rv2075c/MT2135 in the context of M. tuberculosis pathogenicity?

Advanced proteomics strategies provide powerful tools for characterizing Rv2075c/MT2135 in relation to M. tuberculosis virulence:

• Discovery-Based Mass Spectrometry:

  • Shotgun proteomics can identify differential expression of Rv2075c/MT2135 across M. tuberculosis strains with varying virulence

  • Label-free quantification methods (iBAQ, NSAF, SWATH-MS) can determine relative abundance

• Targeted Proteomics for Validation:

  • Selected Reaction Monitoring (SRM) assays should be designed and optimized for Rv2075c/MT2135

  • Multiple reaction monitoring (MRM) provides higher sensitivity and specificity for detection in complex samples

• Integration with Clinical Phenotyping:

  • Stratify clinical M. tuberculosis isolates by disease severity using established criteria

  • Correlate Rv2075c/MT2135 expression levels with patient outcomes and tuberculosis severity scores like TReAT

  • Example stratification approach:

• Protein-Protein Interaction Studies:

  • Immunoprecipitation coupled with mass spectrometry to identify Rv2075c/MT2135 binding partners

  • Yeast two-hybrid or bacterial two-hybrid systems to validate interactions

  • Network analysis to place Rv2075c/MT2135 in M. tuberculosis pathogenicity pathways

What is known about the genomic context of Rv2075c in relation to mycobacterial evolution and pathogenicity?

Rv2075c is located within the RD9 region, a genomic segment that shows variation across mycobacterial species and strains. Analysis of this genomic context provides insights into evolutionary relationships:

• Phylogenetic Analysis:

  • RD9 (containing Rv2075c) is one of the regions of difference used to distinguish between members of the Mycobacterium tuberculosis complex (MTBC)

  • The presence/absence of RD9 helps define evolutionary lineages within mycobacteria

• Genomic Downsizing Observations:

  • Studies indicate M. tuberculosis has undergone genomic downsizing during evolution

  • RD regions often contain genes lost during adaptation to specific hosts or environments

  • PCR analysis using primers RD9-intF (CGATGGTCAACACCACTACG) and RD9-intR (CTGGACCTCGATGACCACTC) can verify the presence of the Rv2075c region

• Comparative Genomics:

  • Analysis of Rv2075c/MT2135 presence across clinical isolates can be correlated with:

    • Drug resistance patterns

    • Virulence characteristics

    • Host adaptation mechanisms

• Gene Expression Analysis:

  • Transcriptional studies reveal that deletion of certain RD regions (like RD1) can affect expression of genes outside the specific loci

  • Changes in Rv2075c expression might influence other genes in the M. tuberculosis genome, creating cascading phenotypic effects

What challenges exist in functional characterization of Rv2075c/MT2135, and how can researchers address them?

Functional characterization of uncharacterized proteins like Rv2075c/MT2135 presents several methodological challenges:

• Expression System Limitations:

  • M. tuberculosis proteins often exhibit poor solubility in heterologous systems

  • Solution: Optimize expression using multiple tags (His, GST, MBP) and test various induction conditions (temperature, IPTG concentration, time)

  • Solution: Consider specialized mycobacterial expression systems or cell-free systems when standard approaches fail

• Protein Purification Challenges:

  • Membrane-associated or hydrophobic proteins may require specialized purification methods

  • Solution: Test different detergents or solubilization buffers optimized for mycobacterial proteins

  • Solution: Consider on-column refolding strategies during purification

• Functional Assay Development:

  • Without known function, assay design relies on predictions and homology

  • Solution: Use computational predictions of protein function based on structural homology

  • Solution: Employ phenotypic screens comparing wild-type and knockout strains across diverse growth conditions

  • Solution: Utilize CRISPR/Cas9 genome editing in M. tuberculosis to create inducible expression systems for functional studies

• Validation in Physiological Context:

  • In vitro findings may not reflect in vivo function

  • Solution: Develop cell infection models using macrophages to assess Rv2075c/MT2135 role during infection

  • Solution: Where ethically approved, animal models can validate findings in a physiological context

• Data Integration Challenges:

  • Multiple -omics approaches generate complex datasets

  • Solution: Utilize integrated bioinformatics pipelines to correlate genomic, transcriptomic, and proteomic datasets

  • Solution: Apply machine learning approaches to identify patterns associated with Rv2075c/MT2135 expression

How can researchers design experiments to determine if Rv2075c/MT2135 influences M. tuberculosis virulence or drug resistance?

To investigate potential roles of Rv2075c/MT2135 in virulence or drug resistance, researchers should consider comprehensive experimental approaches:

• Gene Knockout and Complementation Studies:

  • Generate Rv2075c knockout strains using CRISPR/Cas9 or homologous recombination

  • Create complemented strains with wild-type Rv2075c or site-directed mutants

  • Assess changes in growth patterns, morphology, and virulence markers

  • Example experimental design:

• Comparative Strain Analysis:

  • Compare Rv2075c expression across clinical isolates with varying virulence

  • Correlate expression levels with disease severity using clinical severity stratification

  • Use bacterial growth kinetics to measure differences between severity groups:

    • Lag phase duration

    • Exponential growth rate

    • Stationary phase characteristics

    • Response to antibiotic challenge

• Transcriptional Response Analysis:

  • RNA-Seq to identify genes differentially expressed in Rv2075c knockout vs. wild-type

  • ChIP-Seq if Rv2075c has potential DNA-binding domains

  • RT-qPCR validation of key virulence-associated genes

• Host-Pathogen Interaction Studies:

  • Macrophage infection models comparing wild-type and Rv2075c-modified strains

  • Cytokine profiling to assess immunomodulatory effects

  • Cell death assays (apoptosis, necrosis, pyroptosis) to evaluate cytotoxicity

• Drug Resistance Testing:

  • Minimum Inhibitory Concentration (MIC) determination for first and second-line TB drugs

  • Time-kill assays under antibiotic pressure

  • Biofilm formation assessment and correlation with persistence

By implementing these methodological approaches, researchers can systematically investigate potential roles of Rv2075c/MT2135 in M. tuberculosis pathogenicity and develop targeted interventions based on their findings.

What mass spectrometry approaches are most effective for detecting and quantifying Rv2075c/MT2135 in complex mycobacterial samples?

Mass spectrometry techniques offer powerful tools for detecting and quantifying Rv2075c/MT2135 in complex samples, with specific methodological considerations:

• Discovery Proteomics Workflow:

  • Sample preparation: Optimized lysis buffers containing detergents suitable for mycobacterial cell walls

  • Shotgun MS using data-dependent acquisition for initial protein identification

  • Label-free quantitation methods such as:

    • Intensity-based absolute quantification (iBAQ)

    • Normalized spectral abundance factor (NSAF)

    • Sequential window acquisition of all theoretical fragment ion spectra (SWATH-MS)

• Targeted Verification Approaches:

  • Selected Reaction Monitoring (SRM) assays optimized for Rv2075c/MT2135

  • Multiple Reaction Monitoring (MRM) targeting specific peptides unique to Rv2075c

  • Example transition selection for MRM-MS:

Note: These are representative examples; actual transitions should be experimentally determined and optimized for the specific instrument used.

• Data Analysis Considerations:

  • False discovery rate control using decoy database strategies

  • Normalization approaches to account for sample variation

  • Statistical analysis methods for comparing abundance across sample types:

    • Statistical Analysis for Microarrays software for analyzing biological and technical replicates

    • Semi-quantitative protein expression analysis using SWATH-MS

• Validation of Quantification:

  • Assessment of quantitative accuracy by comparing shotgun label-free quantitation with targeted MRM results

  • Protein preparation techniques should be standardized to ensure reproducibility

How can researchers apply genome editing techniques to study Rv2075c/MT2135 function in M. tuberculosis?

Modern genome editing approaches offer unprecedented opportunities for studying Rv2075c/MT2135 function:

• CRISPR/Cas9 Applications in Mycobacteria:

  • Design considerations for mycobacterial CRISPR systems:

    • Codon optimization of Cas9 for mycobacterial expression

    • Selection of appropriate promoters for guide RNA expression

    • Targeting strategies to minimize off-target effects

  • Potential modifications:

    • Complete gene knockout

    • Introduction of point mutations to study structure-function relationships

    • Integration of reporter genes for expression monitoring

    • Creation of conditional knockdowns using inducible systems

• Homologous Recombination Approaches:

  • Traditional methods using suicide vectors

  • Two-step allelic exchange strategies

  • Specialized transduction using mycobacteriophages

• Complementation Strategies:

  • Integration at attB sites for stable expression

  • Use of different promoters to modulate expression levels:

    • Native promoter for physiological expression

    • Inducible promoters for controlled expression

    • Strong constitutive promoters for overexpression studies

• Expression Monitoring Systems:

  • Fusion with reporter proteins (GFP, luciferase) to track localization and expression

  • Application of degron tags for controlled protein degradation

  • Epitope tagging for immunodetection and localization studies

• Recombineering Techniques:

  • Bacteriophage recombination proteins to enhance homologous recombination efficiency

  • Single-stranded DNA recombineering for introducing point mutations

  • Multiplex genome editing for studying genetic interactions

What computational approaches can predict the function of Rv2075c/MT2135 based on sequence and structural features?

Computational methods provide valuable insights for generating testable hypotheses about the function of uncharacterized proteins:

• Sequence-Based Functional Prediction:

  • Homology searches using PSI-BLAST, HHpred, or HMMER against characterized protein databases

  • Motif identification using PROSITE, PRINTS, or InterProScan

  • Domain architecture analysis using Pfam or SMART

  • Sequence conservation analysis across mycobacterial species

• Structural Prediction and Analysis:

  • Ab initio or template-based 3D structure prediction using AlphaFold2, I-TASSER, or SWISS-MODEL

  • Structural comparison with characterized proteins using DALI or TM-align

  • Active site prediction using CASTp or POOL

  • Protein-protein interaction surface prediction using PredUs or SPPIDER

• Systems Biology Integration:

  • Functional interaction network construction using STRING or Cytoscape

  • Pathway enrichment analysis of predicted interaction partners

  • Co-expression analysis across diverse conditions

  • Identification of syntenic genomic regions across related species

• Machine Learning Approaches:

  • Support vector machines or random forests trained on known protein functions

  • Deep learning models integrating sequence, structure, and genomic context

  • Ensemble methods combining multiple prediction algorithms

• Evolutionary Analysis:

  • Selection pressure analysis using dN/dS ratios

  • Phylogenetic profiling to identify co-evolving genes

  • Ancestral sequence reconstruction to trace evolutionary trajectories

What emerging technologies might enhance our understanding of Rv2075c/MT2135 and its role in M. tuberculosis biology?

Several cutting-edge technologies show promise for advancing research on Rv2075c/MT2135:

• Single-Cell Proteomics:

  • Applications to heterogeneous mycobacterial populations

  • Detection of cell-to-cell variation in Rv2075c/MT2135 expression

  • Correlation with phenotypic heterogeneity in drug tolerance

• Cryo-Electron Microscopy:

  • High-resolution structural characterization of Rv2075c/MT2135

  • Visualization of protein complexes and interaction partners

  • Structural changes under different physiological conditions

• Spatial Transcriptomics and Proteomics:

  • Localization of Rv2075c/MT2135 expression within granulomas

  • Spatial correlation with host immune markers

  • Microenvironmental influences on expression patterns

• Microfluidics and Organ-on-Chip Models:

  • Real-time monitoring of Rv2075c/MT2135 expression during infection

  • Manipulation of microenvironmental conditions

  • High-throughput screening of conditions affecting expression

• Multi-omics Integration:

  • Combined analysis of genomics, transcriptomics, proteomics, and metabolomics data

  • Machine learning approaches to identify regulatory networks

  • Systems biology modeling of Rv2075c/MT2135 function in cellular context

How might understanding Rv2075c/MT2135 contribute to tuberculosis diagnostics, prevention, or treatment?

Translational applications of Rv2075c/MT2135 research may include:

• Diagnostic Applications:

  • Development of antibody-based detection methods for Rv2075c/MT2135

  • Inclusion in multi-antigen panels for improved TB diagnosis

  • Potential biomarker for specific M. tuberculosis lineages or virulence phenotypes

• Vaccine Development:

  • Assessment of Rv2075c/MT2135 as a potential vaccine antigen

  • Investigation of immunomodulatory properties

  • Inclusion in subunit vaccine formulations if immunogenic properties are confirmed

• Drug Development:

  • Evaluation as a potential drug target if essential for virulence

  • Structure-based drug design if enzymatic function is identified

  • Development of inhibitors targeting protein-protein interactions

• Host-Directed Therapies:

  • Understanding how Rv2075c/MT2135 interacts with host immune components

  • Identification of host pathways modulated by Rv2075c/MT2135

  • Development of interventions to counter immunomodulatory effects

• Personalized Medicine Approaches:

  • Correlation of Rv2075c/MT2135 sequence variants with treatment outcomes

  • Stratification of patients based on infecting strain characteristics

  • Tailored treatment regimens based on molecular profiles

By pursuing these research directions, investigators can contribute to both fundamental understanding of M. tuberculosis biology and development of improved clinical interventions for tuberculosis.