Recombinant Uncharacterized protein Rv2571c/MT2647 (Rv2571c, MT2647)

What protein family does Rv2571c belong to and what is its putative function?

Rv2571c is predicted to encode a transmembrane protein of the aromatic amino acid exporter family and contains a FUSC2 (fusaric acid resistance protein-like) domain (E value of 1.1e-13) . These proteins are typically involved in export of fusaric acid, suggesting Rv2571c likely functions as a membrane transporter protein . Interestingly, experimental evidence contradicts the predicted exporter function, as deletion of Rv2571c confers resistance to arylamide compounds, suggesting it may actually be involved in compound import rather than efflux . Researchers investigating the functional characteristics of Rv2571c should consider both import and export assays using radiolabeled substrates or fluorescent probes to definitively characterize its transport directionality.

What methods can be used to generate and confirm Rv2571c deletion mutants?

An unmarked deletion strain of Rv2571c can be constructed using homologous recombination techniques . The methodology involves:

• Construction of a suicide vector containing approximately 1 kb of sequence upstream and downstream of the gene

• The vector should carry hygromycin and kanamycin resistance markers (hyg, kan), as well as sucrose sensitivity (sacB) and β-galactosidase (lacZ) genes for selection

• The upstream region can be amplified using primers TCAGCAACGTAAGGAGT and TACCGCGACGAGGACTT

• The downstream region can be amplified using primers GCCGAGATCGAGGTT and GGATCCAGGTAGCCCGACACATA

• Single crossover strains are generated by electroporation

• Double crossover (DCO) strains are selected/screened on sucrose and X-Gal agar plates

• Confirmation of deletion is performed by PCR amplification using primers AAACCGGAATGGGAGGAC and GTTGCTGAGCGGTAATGG

• Final validation requires Southern blotting and sequencing to ensure precise deletion of the entire gene from start to stop codon

This methodological approach ensures generation of clean deletion mutants suitable for detailed functional characterization.

What is the optimal approach for complementation studies of Rv2571c mutants?

Complementation of Rv2571c deletion or mutant strains can be effectively achieved using an extrachromosomal plasmid with tetracycline-inducible promoter control . The approach involves:

• Cloning a PCR product of the wild-type Rv2571c gene using primers TTAATTAAATAGATGCCCAGCCCA and TTAATTAATGGCCGAGATCGAGGTT into vectors such as pDTCF or pDTNF

• The tetracycline-inducible system allows titration of expression levels using varying concentrations of anhydrotetracycline (ATc)

• Careful consideration of expression levels is critical as overexpression of Rv2571c causes toxicity

• MIC determination in the complemented strain should be performed in the absence or at very low concentrations of ATc due to the leaky expression of the inducible system

• Growth rate analysis should be conducted at multiple ATc concentrations (0-100 ng/ml) to determine the optimal expression level that restores wild-type phenotype without inducing toxicity

This approach allows for controlled complementation studies that can confirm the direct relationship between Rv2571c function and observed phenotypes.

How can researchers isolate and characterize spontaneous resistant mutants to study Rv2571c function?

To isolate spontaneous resistant mutants for Rv2571c functional studies, researchers should follow this methodological approach:

• Prepare solid medium plates containing arylamide compounds at 5× MIC99

• Plate appropriate dilutions of M. tuberculosis culture to obtain isolated colonies

• Isolate resistant colonies and confirm resistance by growth on plates containing 5× MIC99 of the compound

• Confirm resistance in liquid medium by determining MIC90 values

• Extract genomic DNA and sequence Rv2571c gene to identify spontaneous mutations

• Perform whole-genome sequencing to identify any potential additional mutations

• Validate the role of identified mutations by complementation with wild-type Rv2571c gene

This approach has successfully identified multiple mutations in Rv2571c associated with resistance, including frameshifts, premature stop codons, and amino acid substitutions throughout the protein structure, as shown in the following table:

*The chromatogram suggested a mixed population of mutant and wild-type alleles .

How does deletion or mutation of Rv2571c confer resistance to arylamide compounds?

Deletion or mutation of Rv2571c confers resistance to arylamide (AMI) compounds through a mechanism that appears to involve compound transport. The evidence suggests Rv2571c functions as an import transporter, and its inactivation prevents compounds from entering the cell to reach their intracellular targets .

Multiple lines of experimental evidence support this mechanism:

• Spontaneous resistant mutants consistently show mutations in Rv2571c

• Many of these mutations are frameshifts or premature stop codons, indicating that loss of function confers resistance

• Targeted deletion of Rv2571c results in high-level resistance to multiple AMI compounds

• Complementation with wild-type Rv2571c restores sensitivity in resistant mutants

• The compound specificity (active only when butyrate is the sole carbon source) suggests that the intracellular target may be conditionally essential

The MIC data clearly demonstrates this resistance pattern as shown in the following table:

This data shows that deletion strains exhibit at least 20-fold higher MIC values than wild-type strains across multiple AMI compounds .

What is the relationship between carbon source and arylamide compound efficacy in relation to Rv2571c?

Arylamide compounds demonstrate a unique carbon source-dependent efficacy profile that appears intimately connected to Rv2571c function. The compounds are only active against M. tuberculosis when butyrate is used as the sole carbon source; they lose activity when glucose is the sole carbon source . This conditional activity suggests:

• The compounds may target a metabolic pathway specifically essential during growth on butyrate

• Rv2571c expression or function may be upregulated during growth on butyrate

• The intracellular target of AMI compounds is likely involved in fatty acid metabolism, as butyrate is a short-chain fatty acid

Researchers investigating this relationship should employ:

• Transcriptomic analysis comparing Rv2571c expression levels under different carbon sources

• Metabolomic profiling to identify shifts in metabolic pathways

• Isotopic labeling studies to track metabolic flux changes

• Protein interaction studies to identify potential binding partners specific to butyrate metabolism

This carbon source dependency provides an important research angle for understanding both Rv2571c function and developing targeted antimycobacterial compounds.

What mutations in Rv2571c are associated with resistance to arylamide compounds and where do they map on the protein?

Multiple spontaneous mutations in Rv2571c have been identified that confer resistance to arylamide compounds. These mutations map throughout the protein structure, affecting both transmembrane helices and the intracellular domain :

• Transmembrane helix 1 (TM1): Q29, D43

• Transmembrane helix 3 (TM3): L81P

• TM4/5 junction: V199A

• Transmembrane helix 5 (TM5): A140P

• Transmembrane helix 6 (TM6): R149, D152, A160

• Intracellular domain: A204, V243, Y256, A311

The distribution of resistance mutations throughout the protein suggests multiple functional regions may be important for compound interaction. Several patterns emerge from the mutation analysis:

• Frameshift and premature stop codons indicate loss-of-function leads to resistance

• Proline substitutions (L81P, A140P) likely disrupt protein structure

• Even seemingly minor mutations (V119A, R149H) confer resistance, suggesting precise structural requirements for function

• The consistent pattern of resistance mutations across multiple independent isolations confirms Rv2571c's central role in AMI compound activity

These mutation patterns provide valuable insights for structure-function studies and rational drug design targeting Rv2571c-dependent pathways.

How can overexpression toxicity of Rv2571c be leveraged for antimycobacterial drug development?

The observation that overexpression of Rv2571c is toxic to M. tuberculosis presents a promising avenue for drug development. This toxicity manifests in both wild-type and knockout strains, and occurs under both glucose and butyrate carbon source conditions, with severity increasing in an ATc concentration-dependent manner . Researchers can exploit this toxicity through:

• Development of compounds that increase Rv2571c expression by targeting its transcriptional regulators

• Design of molecules that enhance Rv2571c activity, potentially causing toxic accumulation of transported substrates

• Creation of Rv2571c protein variants with increased transport activity

• Combination approaches using sub-inhibitory concentrations of compounds that require Rv2571c for entry with modulators that increase Rv2571c expression or activity

Growth inhibition studies have demonstrated significant toxicity at higher ATc concentrations (100 ng/ml), providing proof-of-concept for this approach . Researchers should employ transcriptional reporter assays, transporter activity assays, and high-throughput screening to identify compounds that modulate Rv2571c expression or function.

What methodologies can be employed to identify the natural substrate of Rv2571c transporter?

Identifying the natural substrate of Rv2571c requires a multifaceted approach:

• Metabolomics comparison between wild-type and Rv2571c deletion strains:

  • Use untargeted LC-MS/MS to identify metabolites that accumulate or decrease in the deletion mutant

  • Focus on aromatic compounds based on the protein's classification in the aromatic amino acid exporter family

  • Compare metabolic profiles under different carbon sources, particularly butyrate vs. glucose

• Transport assays using membrane vesicles:

  • Prepare inverted membrane vesicles from wild-type and deletion strains

  • Test transport of radiolabeled or fluorescently labeled candidate substrates

  • Monitor ATP-dependent or proton gradient-dependent transport

• Protein structure prediction and docking studies:

  • Generate improved structural models using modern AI-based prediction tools

  • Perform in silico docking of potential substrates

  • Validate predictions through site-directed mutagenesis of key residues

• Transcriptional response analysis:

  • Identify conditions that regulate Rv2571c expression

  • Determine co-regulated genes that may be functionally related

  • Use this information to narrow potential metabolic pathways involving the natural substrate

This comprehensive approach addresses the challenge of identifying natural substrates for transporters in the absence of prior knowledge.

How can site-directed mutagenesis be used to distinguish between substrate binding and transport function of Rv2571c?

Site-directed mutagenesis provides a powerful approach to dissect the specific functions of Rv2571c domains and residues:

• Design a mutagenesis strategy targeting:

  • Conserved residues in each transmembrane helix

  • Residues where spontaneous resistance mutations occur

  • Putative substrate binding regions based on homology with other transporters

  • Energy coupling domains for ATP binding or proton coupling

• Create a panel of point mutations:

  • Conservative substitutions (maintain similar amino acid properties)

  • Non-conservative substitutions (change amino acid properties)

  • Systematic alanine scanning of transmembrane regions

• Functional characterization of mutants:

  • Substrate binding assays using purified protein or membrane preparations

  • Transport assays measuring uptake rates

  • Resistance profiling against arylamide compounds

  • Protein expression and localization verification

• Interpretation framework:

  • Mutations that eliminate both binding and transport indicate substrate interaction sites

  • Mutations that maintain binding but eliminate transport indicate transport machinery

  • Mutations that affect substrate specificity help map the binding pocket

This methodological approach has been successfully applied to other transporters and would provide valuable insights into Rv2571c function.

How conserved is Rv2571c across mycobacterial species and what does this suggest about its evolutionary importance?

A comprehensive evolutionary analysis of Rv2571c requires examination of its conservation pattern across mycobacterial species:

• Perform phylogenetic analysis:

  • Identify homologs across mycobacterial species using BLAST searches

  • Generate multiple sequence alignments using MUSCLE or MAFFT

  • Construct phylogenetic trees using maximum likelihood or Bayesian methods

  • Calculate selection pressures (dN/dS ratios) across different protein domains

• Conservation analysis methodology:

  • Compare Rv2571c sequences from pathogenic vs. non-pathogenic mycobacteria

  • Identify highly conserved residues as potential functionally essential sites

  • Map conservation patterns onto the predicted protein structure

  • Correlate conservation with resistance mutation sites

• Genomic context analysis:

  • Examine synteny (gene order conservation) around Rv2571c across species

  • Identify co-evolved gene clusters that may indicate functional relationships

  • Determine if Rv2571c is within horizontally transferred genomic islands

While specific conservation data is not provided in the search results, this methodological framework would reveal whether Rv2571c represents a core mycobacterial function or an adaptation specific to M. tuberculosis pathogenesis .

What functional assays can differentiate between import and export activities of Rv2571c?

Determining whether Rv2571c functions primarily as an importer or exporter requires specific transport assays:

• Inside-out vesicle assays:

  • Prepare inverted membrane vesicles from wild-type and Rv2571c deletion strains

  • Load vesicles with potential substrates or arylamide compounds

  • Measure efflux (decrease in vesicle-associated substrate)

  • If Rv2571c functions as an importer in intact cells, it would function as an exporter in inverted vesicles

• Whole-cell accumulation assays:

  • Expose wild-type and deletion strains to labeled substrates or arylamide compounds

  • Measure intracellular accumulation over time

  • Importers would show reduced accumulation in deletion strains

  • Exporters would show increased accumulation in deletion strains

• Competition assays:

  • Test whether potential substrates compete with arylamide compound uptake

  • Measure arylamide efficacy in the presence of increasing concentrations of candidate substrates

  • Competition would indicate shared transport pathway

• Heterologous expression systems:

  • Express Rv2571c in a well-characterized host (E. coli, yeast)

  • Measure substrate transport in the heterologous system

  • Use transport-deficient host strains for clearer results

These complementary approaches would provide definitive evidence regarding the directionality of Rv2571c transport activity.

How does the function of Rv2571c relate to other known bacterial FUSC2 domain-containing proteins?

Comparative analysis of Rv2571c with other FUSC2 domain-containing proteins requires:

• Structural comparison methodology:

  • Identify bacterial proteins with FUSC2 domains across diverse species

  • Generate structural models using homology modeling or AI-based prediction tools

  • Compare transmembrane topology and domain organization

  • Identify conserved motifs that may indicate shared functional mechanisms

• Functional comparison:

  • Review literature on characterized FUSC2 proteins like fusaric acid resistance proteins

  • Compare substrate specificities, transport mechanisms, and regulatory patterns

  • Determine if FUSC2 domains typically associate with import or export functions

  • Identify whether FUSC2 proteins typically transport similar chemical classes

• Genomic context analysis:

  • Compare genomic neighborhoods of FUSC2 genes across bacteria

  • Identify frequently co-occurring genes that may indicate functional relationships

  • Determine if FUSC2 genes are commonly associated with specific metabolic pathways

The search results indicate that FUSC2 domains are typically associated with fusaric acid resistance (export) functions, making the apparent import function of Rv2571c particularly intriguing and worthy of detailed comparative analysis .