Recombinant Ustilago maydis Mitochondrial import inner membrane translocase subunit TIM50 (TIM50)

What is TIM50 and what is its primary function in mitochondria?

TIM50 is a novel component of the mitochondrial inner membrane preprotein translocase system (TIM23 complex), which serves as the main entry gate for proteins destined for the matrix and inner membrane. TIM50 spans the inner membrane with a single transmembrane segment and exposes a large hydrophilic domain in the intermembrane space. Its primary function appears to be mediating the transfer of preproteins from the translocase of the outer membrane (TOM complex) to the TIM23 complex through the intermembrane space . Studies have demonstrated that mitochondria depleted of TIM50 display significantly reduced import kinetics of preproteins utilizing the TIM23 complex, underscoring its essential role in mitochondrial protein import .

What are the structural characteristics of recombinant Ustilago maydis TIM50?

The recombinant full-length Ustilago maydis TIM50 protein (Q4PEW9) consists of amino acids 40-493 of the mature protein and is typically produced with an N-terminal His tag when expressed in E. coli . The protein contains several key structural elements, including:

• A transmembrane domain that anchors it in the inner mitochondrial membrane

• A large intermembrane space (IMS) domain that interacts with incoming preproteins

• Specific binding sites that facilitate interactions with presequences

Crystal structure analysis of the IMS domain of TIM50 (residues 176-361) reveals a structure with a large groove that likely serves as a binding site for presequences . The structure was refined to a resolution of 1.83 Å with an R-factor of 19.3% and R-free of 22.4%, indicating high structural quality .

How does Ustilago maydis TIM50 compare with TIM50 from other organisms?

While the search results do not provide direct comparison between U. maydis TIM50 and orthologs from other species, functional studies of TIM50 have been conducted in various organisms including yeast (Saccharomyces cerevisiae) and Neurospora crassa. The core function of TIM50 as a component of the mitochondrial protein import machinery appears to be conserved, but there may be species-specific variations in structural details and regulatory mechanisms . Of note, TIM50 is essential for viability in yeast, highlighting its evolutionary importance in eukaryotic cells .

What is the crystallographic structure of TIM50's IMS domain and what does it reveal about its function?

The crystal structure of the TIM50 IMS domain has been determined at 1.83 Å resolution. The structure reveals that TIM50 crystallizes in the P6₁22 space group with cell dimensions a = 84.109 Å and c = 116.549 Å . Key structural features include:

The structure contains a large groove that serves as a putative binding site for presequences, suggesting a direct role in preprotein recognition . The structural analysis provides insight into how TIM50 may interact with incoming preproteins during their translocation across the mitochondrial membranes.

How does TIM50 interact with preproteins during mitochondrial import?

TIM50 interacts with preproteins as they emerge from the TOM complex on the intermembrane space side of the outer membrane. Cross-linking experiments have demonstrated that TIM50 can be cross-linked to preproteins that are halted at the level of the TOM complex or spanning both TOM and TIM23 complexes .

In time-course experiments, researchers observed that:

• When a precursor protein was accumulated at the TOM complex in the absence of membrane potential (ΔΨ)

• And subsequently a ΔΨ was re-established

• The cross-linked species between TIM50 and the precursor was observed at time zero

• This cross-linking decreased over time as the precursor was processed and imported

These findings suggest that TIM50 engages with preproteins as soon as they reach the trans side of the TOM complex and maintains this interaction as long as segments of the preprotein remain in the intermembrane space . This provides strong evidence for TIM50's role as a critical mediator in the transfer of preproteins between the TOM and TIM23 complexes.

What are the optimal storage and reconstitution conditions for recombinant Ustilago maydis TIM50?

For optimal storage and reconstitution of recombinant U. maydis TIM50, the following protocols are recommended :

Storage conditions:

• Store lyophilized powder at -20°C/-80°C upon receipt

• Aliquoting is necessary for multiple use to avoid repeated freeze-thaw cycles

• Working aliquots can be stored at 4°C for up to one week

• The protein is typically supplied in a Tris/PBS-based buffer containing 6% Trehalose, pH 8.0

Reconstitution protocol:

• Briefly centrifuge the vial prior to opening to bring contents to the bottom

• Reconstitute the protein in deionized sterile water to a concentration of 0.1-1.0 mg/mL

• Add glycerol to a final concentration of 5-50% (recommended 50%)

• Aliquot for long-term storage at -20°C/-80°C

• Avoid repeated freeze-thaw cycles as this can compromise protein integrity

How can cross-linking experiments be designed to study TIM50 interactions with preproteins?

Cross-linking experiments provide valuable insights into the transient interactions between TIM50 and preproteins during mitochondrial import. Based on published methodologies, researchers can follow this experimental approach :

• Preparation of precursor proteins:

  • Generate radiolabeled precursor proteins by in vitro translation

  • For intermediates spanning both TOM and TIM23 complexes, use fusion proteins with dihydrofolate reductase (DHFR) domains that can be arrested by methotrexate (MTX)

• Accumulation of import intermediates:

  • To trap precursors at the TOM complex level: pre-incubate mitochondria with protonophores like CCCP (50 μM) and valinomycin (0.5 μM) to dissipate membrane potential before adding precursor proteins

  • For spanning intermediates: pre-incubate precursor protein with MTX and NADPH, then import into energized mitochondria in the presence of 2 μM MTX and 5 mM NADPH

• Cross-linking procedure:

  • Chill samples on ice after import reaction

  • Add cross-linker DFDNB to a final concentration of 200 μM

  • Incubate for 30 minutes

  • Quench reaction by adding 1/10 volume of 1 M glycine pH 8.8

  • Re-isolate mitochondria and solubilize in SDS-containing buffer

• Analysis of cross-linked products:

  • Perform immunoprecipitation with antibodies against Tim50

  • Analyze by SDS-PAGE and autoradiography

• Chase experiments:

  • De-energize mitochondria with 50 μM CCCP

  • Add precursor protein

  • Re-isolate mitochondria and re-establish membrane potential with 2 mM DTT and 5 mM NADH

  • Remove aliquots at different time points for analysis of import and cross-linking

This approach allows researchers to track the temporal interactions between TIM50 and preproteins during different stages of the import process .

What methods can be used to generate TIM50 knockout models for functional studies?

The CRISPR-Cas9 technique has been successfully employed to generate global TIM50 knockout models for functional studies . The process involves:

• Guide RNA design:

  • Use online CRISPR design tools (e.g., http://crispr.mit.edu) to predict guide sequences targeting the TIM50 gene

  • Design complementary oligomers for annealing (example oligos: TAGGCCTTGGAGCCCCCACGGT and AAACACCGTGGGGGCTCCAAGG)

• Cloning and transcription:

  • Anneal oligomers and clone into a suitable sgRNA expression vector (e.g., pUC57-sgRNA)

  • Transcribe sgRNA using the MEGAshortscript Kit

  • Transcribe Cas9 using a T7 Ultra Kit

• Microinjection:

  • Inject Cas9 and sgRNA mRNA into single-cell embryos using a micro-injection system

  • Culture injected embryos to generate founder animals

• Genotyping:

  • Design PCR primers flanking the target site (example primer: TIM50-238-F [5′-CTGGATGTCCACTTCCTGGT-3′])

  • Perform PCR analysis to identify successful editing events

  • Confirm mutations by sequencing

For tissue-specific studies, cardiac-specific TIM50 overexpression mice have also been generated, suggesting that tissue-specific knockout approaches could be developed using Cre-loxP systems .

How does TIM50 contribute to cellular responses under stress conditions?

TIM50 has been identified as a novel protective regulator in certain stress conditions, particularly in the context of cardiac hypertrophy . Research findings suggest that:

• TIM50 expression levels in human heart samples can be measured to assess its potential role in cardiac function

• Global TIM50 knockout mice exhibit specific phenotypes related to cardiac function

• TIM50 cardiac-specific overexpression models can be used to investigate protective mechanisms against hypertrophy

The relationship between TIM50 and oxidative stress has been explored, with evidence suggesting that TIM50 may modulate biological processes related to cellular stress responses . The exact molecular mechanisms by which TIM50 exerts these protective effects remain an active area of investigation, but likely involve its role in maintaining proper mitochondrial protein import and potentially other non-canonical functions.

What is the relationship between TIM50 function in Ustilago maydis and its pathogenicity in maize?

Ustilago maydis is a biotrophic fungal pathogen that causes tumor formation in maize plants . While the direct relationship between TIM50 function and U. maydis pathogenicity is not explicitly described in the search results, understanding mitochondrial function in this organism could provide insights into its virulence mechanisms.

U. maydis secretes effector proteins during host penetration and colonization to overcome plant immune responses and reprogram host physiology . The proper function of mitochondria, facilitated by proteins like TIM50, is likely crucial for:

• Energy production during the infection process

• Cellular adaptation to changing environments during host colonization

• Proper folding and processing of secreted effector proteins

Research has identified specific U. maydis effectors like Topless (TPL) interacting protein 6 (Tip6) that interact with plant corepressors to disrupt host transcriptional regulation . Future studies could investigate whether mitochondrial function, potentially involving TIM50, plays a role in these host-pathogen interactions.

How can structural information about TIM50 be leveraged for protein engineering applications?

The crystal structure of the TIM50 IMS domain provides valuable information that can be leveraged for protein engineering applications . Potential approaches include:

• Structure-guided mutagenesis:

  • Identify key residues in the putative presequence-binding groove

  • Generate point mutations to alter binding specificity or affinity

  • Analyze effects on preprotein recognition and import efficiency

• Domain engineering:

  • Create chimeric proteins combining domains from TIM50 with other protein translocases

  • Develop synthetic protein import systems with altered specificity

  • Engineer TIM50 variants with enhanced stability or solubility

• Drug design applications:

  • Use the binding groove as a template for designing small molecules that could modulate protein import

  • Develop inhibitors that specifically target fungal TIM50 as potential antifungal agents

  • Create tools to manipulate mitochondrial protein import in research applications

The high-resolution structural data (1.83 Å) provides an excellent foundation for these engineering approaches .

What are common challenges in working with recombinant TIM50 and how can they be addressed?

Working with recombinant mitochondrial membrane proteins like TIM50 presents several challenges:

• Protein solubility issues:

  • Challenge: TIM50 contains a transmembrane domain that may cause aggregation

  • Solution: Use appropriate detergents or reconstitute in liposomes to maintain native conformation

  • Recommendation: The supplied lyophilized protein should be reconstituted following the specific buffer conditions (Tris/PBS-based buffer with 6% Trehalose, pH 8.0)

• Protein stability during storage:

  • Challenge: Repeated freeze-thaw cycles can lead to protein degradation

  • Solution: Aliquot the protein after reconstitution and add glycerol (recommended final concentration 50%)

  • Recommendation: Store working aliquots at 4°C for up to one week; longer storage requires -20°C/-80°C conditions

• Functional assays:

  • Challenge: Assessing the activity of isolated TIM50 outside its native membrane environment

  • Solution: Develop robust in vitro binding assays using synthetic presequences or model substrates

  • Recommendation: Cross-linking approaches with radiolabeled preproteins can be used to verify binding activity

How can researchers verify the quality and activity of recombinant Ustilago maydis TIM50?

To verify the quality and activity of recombinant U. maydis TIM50, researchers can employ several complementary approaches:

• Purity assessment:

  • SDS-PAGE analysis to confirm >90% purity as specified in product information

  • Western blotting with anti-His tag or anti-TIM50 antibodies to confirm identity

• Structural integrity:

  • Circular dichroism (CD) spectroscopy to assess secondary structure content

  • Limited proteolysis to verify proper folding

  • Size exclusion chromatography to assess aggregation state

• Functional validation:

  • Presequence binding assays using synthetic mitochondrial targeting sequences

  • In vitro reconstitution with other components of the TIM23 complex

  • Cross-linking experiments with model preproteins as described in published protocols

• Integration into liposomes:

  • Reconstitution into liposomes to mimic the native membrane environment

  • Assessment of preprotein binding in this reconstituted system

What are the methodological considerations for studying TIM50 interactions in different experimental systems?

When studying TIM50 interactions across different experimental systems, several methodological considerations should be taken into account:

• In vitro binding studies:

  • Use purified components with defined buffer conditions

  • Consider the effect of detergents or lipids on interaction dynamics

  • Employ multiple techniques (e.g., pull-down assays, surface plasmon resonance) to verify interactions

• Isolated mitochondria experiments:

  • Ensure mitochondrial integrity during isolation procedures

  • Control the energetic state of mitochondria (presence/absence of membrane potential)

  • For cross-linking studies, optimize cross-linker concentration and reaction time

  • When arresting preproteins, verify the effectiveness of inhibitors like CCCP (50 μM) and valinomycin (0.5 μM)

• Cellular models:

  • Consider tissue-specific differences in TIM50 expression and function

  • For knockout/knockdown studies, verify the efficiency of gene targeting

  • In complementation experiments, ensure appropriate expression levels

• Organism-specific considerations:

  • When studying U. maydis TIM50, consider the unique aspects of fungal mitochondria

  • For comparative studies across species, account for potential differences in mitochondrial import mechanisms

  • When studying TIM50 in the context of U. maydis pathogenicity in maize, consider the plant-specific experimental conditions