Recombinant Xenopus laevis SHC SH2 domain-binding protein 1 homolog A (shcbp1-a), partial

What is Recombinant Xenopus laevis SHC SH2 domain-binding protein 1 homolog A (shcbp1-a)?

Recombinant Xenopus laevis SHC SH2 domain-binding protein 1 homolog A (shcbp1-a) is a protein derived from the African clawed frog (Xenopus laevis). The protein is produced using recombinant technology in various expression systems including yeast, E. coli, baculovirus, and mammalian cells. This protein is available in different formats including with various tags such as Avi-tag Biotinylated versions, where E. coli biotin ligase (BirA) specifically attaches biotin to the 15 amino acid AviTag peptide through an amide linkage. The recombinant protein is typically provided as a lyophilized powder with purity >85% as confirmed by SDS-PAGE analysis .

What is the role of SHCBP1 in cellular processes?

SHCBP1 serves critical functions in cellular proliferation and metabolism. Research shows that SHCBP1 contributes to cellular growth and proliferation pathways, particularly in highly proliferative cells. In neural stem progenitor cells (NSPCs), SHCBP1 appears to be involved in metabolic regulation, specifically in the shift toward glycolytic metabolism that occurs during high proliferation states. This metabolic shift is essential for activating anabolic pathways that generate cellular building blocks needed for growth and division. Additionally, SHCBP1 has been identified as a downstream target of various signaling pathways, suggesting its role in transducing growth and differentiation signals within cells .

How should Recombinant Xenopus laevis SHCBP1-A be stored and handled?

For optimal retention of biological activity, Recombinant Xenopus laevis SHCBP1-A should be stored according to these methodological guidelines:

• Upon receipt, briefly centrifuge the vial to bring contents to the bottom before opening.

• Reconstitute the lyophilized protein in deionized sterile water to a concentration of 0.1-1.0 mg/mL.

• Add glycerol to a final concentration of 5-50% (with 50% being the default recommendation).

• Aliquot the reconstituted protein to minimize freeze-thaw cycles.

• Store aliquots at -20°C or preferably -80°C.

• Avoid repeated freeze-thaw cycles as these significantly reduce protein activity.

The shelf life depends on multiple factors including storage conditions, but proper storage at -80°C maximizes stability .

What expression systems are available for producing Recombinant Xenopus laevis SHCBP1-A?

Recombinant Xenopus laevis SHCBP1-A can be produced in multiple expression systems, each offering distinct advantages depending on research requirements:

The selection of an appropriate expression system should be based on downstream applications and specific requirements for protein activity and modifications .

What methods are effective for SHCBP1 knockdown in experimental models?

For effective knockdown of SHCBP1 in experimental models, researchers have successfully employed RNA interference techniques. Based on published methodologies:

• Lentiviral vector delivery systems have shown high efficiency in transducing various cell types, including difficult-to-transfect cells.

• The knockdown efficiency should be verified using:

  • RT-PCR with SHCBP1-specific primers:
    Forward: 5′-GCTACCGTGATAAACCAGGTTC-3′
    Reverse: 5′-AGGCTCTGAATCGCTCATAGA-3′

  • Western blotting with SHCBP1 antibodies

• GFP fusion expression vectors can be used to monitor transfection efficiency by fluorescence microscopy.

This approach has demonstrated significant knockdown of SHCBP1 in multiple cell lines, resulting in observable phenotypic effects like inhibition of cell proliferation .

How can researchers analyze SHCBP1 expression levels?

Researchers can employ multiple complementary techniques to comprehensively analyze SHCBP1 expression levels:

• Quantitative RT-PCR (RT-qPCR):

  • Extract total RNA using standard protocols.

  • Reverse transcribe to cDNA using PrimeScript Reverse Transcriptase or equivalent systems.

  • Perform qPCR using SYBR-based detection and SHCBP1-specific primers.

  • Analyze data using the ∆∆Cq method with appropriate housekeeping genes (e.g., GAPDH) as internal controls.

• Western Blotting:

  • Extract protein using standard protein extraction protocols.

  • Separate proteins by SDS-PAGE and transfer to membranes.

  • Probe with anti-SHCBP1 antibodies and appropriate secondary antibodies.

  • Quantify band intensity using densitometry.

• Bioinformatic Analysis:

  • Utilize databases such as The Cancer Genome Atlas (TCGA) through platforms like UALCAN (http://ualcan.path.uab.edu).

  • Compare expression levels across different tissues or conditions.

  • Perform statistical analysis using t-tests or ANOVA followed by post-hoc tests as appropriate.

These complementary approaches provide robust verification of expression levels at both RNA and protein levels .

What is the role of SHCBP1 in neural stem progenitor cell function during regeneration?

SHCBP1 plays a crucial role in neural stem progenitor cell (NSPC) function during regeneration, particularly in Xenopus laevis spinal cord regeneration models. Current research indicates that SHCBP1 is involved in the following key processes:

• Metabolic Regulation: SHCBP1 contributes to the transient metabolic shift toward glycolysis that occurs during spinal cord regeneration. This metabolic reprogramming is essential for supporting the high proliferation rate of NSPCs after injury.

• Cellular Proliferation: NSPCs surrounding the spinal cord central canal exhibit increased proliferation following spinal cord injury (SCI), which is critical for compensating cellular loss. SHCBP1 appears to be an important regulator of this proliferative response.

• mTOR Pathway Integration: The temporality of SHCBP1 expression coincides with mTORC1 activation, which is rapidly and transiently activated following SCI. This coordination suggests SHCBP1 may be integrated with the mTOR signaling pathway to regulate NSPC proliferation.

• Regenerative Response: Transcriptomic analyses have shown that genes involved in metabolic processes, including SHCBP1, represent more than 50% of differentially regulated transcripts following SCI, with the highest number of differentially expressed genes occurring at 1-day post-transection.

These findings collectively suggest that SHCBP1 is instrumental in coordinating the metabolic state of NSPCs to support the high energy and biosynthetic demands required during regenerative processes .

How does SHCBP1 contribute to cancer development and progression?

SHCBP1 exhibits significant tumor-promoting effects across multiple cancer types, functioning through several molecular mechanisms:

• Differential Expression: The Cancer Genome Atlas (TCGA) database analysis confirms significantly elevated SHCBP1 expression in gastric cancer (GC) tissues compared to adjacent normal tissues. Similar patterns have been observed in other cancer types.

• Cell Proliferation: Knockdown studies using lentivirus-mediated shRNA targeting SHCBP1 have demonstrated that SHCBP1 depletion significantly inhibits cancer cell growth. High-content screening assays showed a 2.14-fold change in cell proliferation following SHCBP1 knockdown.

• Oncogenic Signaling: SHCBP1 has been identified as a downstream target gene of SS18-SSX1, a fusion oncoprotein implicated in synovial sarcoma pathogenesis. This suggests SHCBP1 may mediate oncogenic signaling in certain cancer contexts.

• Molecular Interaction Network: SHCBP1 appears to interface with multiple signaling pathways involved in cell cycle regulation, survival, and metabolism, positioning it as a potential hub in oncogenic signaling networks.

These findings position SHCBP1 as both a potential biomarker for cancer diagnosis and a promising therapeutic target. Research methodologies targeting SHCBP1 function could provide new approaches for cancer treatment strategies .

What is the relationship between SHCBP1 and metabolic regulation in cellular function?

SHCBP1 appears to play a significant role in cellular metabolic regulation, particularly in contexts requiring high proliferation rates:

• Glycolytic Shift: SHCBP1 expression correlates with a shift toward glycolytic metabolism in highly proliferative cells. This metabolic reprogramming is characterized by increased glucose uptake and lactate production even in the presence of oxygen (aerobic glycolysis).

• Anabolic Support: The glycolytic shift associated with SHCBP1 expression supports anabolic pathways necessary for generating cellular building blocks required for proliferation. This includes nucleotide synthesis, lipid production, and amino acid metabolism.

• Cell Cycle Regulation: High lactate production resulting from glycolytic metabolism can enhance proliferation by modifying cell cycle regulatory proteins. SHCBP1 may mediate this relationship between metabolism and cell cycle progression.

• mTOR Pathway Integration: SHCBP1 function appears to be coordinated with mTOR signaling, which is a master regulator of cellular metabolism. mTORC1 both regulates and is regulated by glycolytic metabolism, suggesting a potential feedback loop involving SHCBP1.

• Temporal Dynamics: The transient nature of metabolic shifts associated with SHCBP1 suggests its role in adapting cellular metabolism to changing physiological demands, such as regeneration after injury or response to growth signals.

Understanding these metabolic regulatory functions of SHCBP1 has implications for both regenerative medicine and cancer research, as metabolic reprogramming is a hallmark of both regenerating tissues and cancer cells .

What statistical approaches are appropriate for analyzing SHCBP1 expression data?

• For comparing SHCBP1 expression between two groups (e.g., tumor vs. normal):

  • Student's t-test for normally distributed data

  • Mann-Whitney U test for non-parametric data

  • Paired t-test when comparing matched samples (e.g., tumor and adjacent normal tissue from the same patient)

• For comparing SHCBP1 expression across multiple groups:

  • One-way Analysis of Variance (ANOVA) followed by post-hoc tests such as Fisher's Least Significant Difference (LSD) test

  • Kruskal-Wallis test for non-parametric data, followed by appropriate post-hoc comparisons

• For temporal expression analysis (e.g., time course after treatment):

  • Repeated measures ANOVA

  • Mixed-effects models for handling missing data points

• For RT-qPCR data analysis:

  • ∆∆Cq method with appropriate reference genes

  • Ensure validation of reference gene stability across experimental conditions

• For defining statistical significance:

  • P-value thresholds should be clearly defined (typically p<0.05)

  • Consider multiple testing corrections (e.g., Bonferroni, Benjamini-Hochberg) for genome-wide or transcriptome analyses

These statistical approaches should be implemented using appropriate software such as SPSS, R, or GraphPad Prism, with all assumptions tested and reported transparently .

How can researchers identify and validate SHCBP1 as a downstream target gene?

To identify and validate SHCBP1 as a downstream target gene of specific factors (e.g., transcription factors or signaling pathways), researchers should employ a multi-step approach combining genomic, transcriptomic, and functional analyses:

• Initial Target Identification:

  • Microarray or RNA-seq profiling after knockdown/overexpression of the upstream factor

  • ChIP-seq to identify direct binding sites of transcription factors to the SHCBP1 promoter

  • Pathway analysis software to identify signaling networks connecting the factor to SHCBP1

• Expression Validation:

  • RT-qPCR to confirm expression changes observed in high-throughput data

  • Western blotting to validate changes at protein level

  • Immunohistochemistry to assess spatial expression patterns in tissues

• Functional Validation:

  • Reporter gene assays using SHCBP1 promoter constructs

  • Site-directed mutagenesis of putative binding sites

  • Chromatin immunoprecipitation (ChIP) to confirm direct binding

• Phenotypic Correlation:

  • Assess whether SHCBP1 knockdown phenocopies effects of upstream factor manipulation

  • Rescue experiments to determine if SHCBP1 overexpression can restore phenotypes caused by upstream factor depletion

• Pathway Integration:

  • Use proteomic approaches (co-IP, mass spectrometry) to identify interacting proteins

  • Investigate effects on downstream signaling using phospho-specific antibodies

This comprehensive approach has successfully identified SHCBP1 as a downstream target of SS18-SSX1 fusion protein in synovial sarcoma, demonstrating how integrated analyses can reveal novel regulatory relationships .

What bioinformatic resources are available for SHCBP1 functional network analysis?

Researchers investigating SHCBP1 functional networks can leverage several bioinformatic resources and databases:

• Expression Analysis Platforms:

  • UALCAN (http://ualcan.path.uab.edu): Provides user-friendly analysis of TCGA data for SHCBP1 expression across cancer types and correlation with clinical parameters.

  • GEPIA (http://gepia.cancer-pku.cn): Offers expression analysis with survival correlation and co-expression networks.

  • cBioPortal: Integrates mutation, copy number, expression, and clinical data for comprehensive multi-omics analysis.

• Functional Network Tools:

  • STRING database: Visualizes known and predicted protein-protein interactions for SHCBP1.

  • GeneMANIA: Generates functional association networks based on co-expression, physical interactions, and shared protein domains.

  • NetworkAnalyst: Allows visualization of SHCBP1-centered regulatory networks across different omics data types.

• Pathway Analysis:

  • KEGG Pathway Database: Identifies pathways involving SHCBP1.

  • Reactome: Provides detailed pathway visualization with emphasis on reactions and processes.

  • Ingenuity Pathway Analysis (IPA): Offers commercial solution for integrated pathway analysis with extensive literature-based knowledge.

• Evolutionary Conservation:

  • Ensembl Comparative Genomics: Examines SHCBP1 conservation across species.

  • PhyloP/PhastCons: Assesses evolutionary conservation at nucleotide level.

• Structural Prediction:

  • AlphaFold: Provides protein structure predictions that can inform functional domains.

  • Swiss-Model: Allows homology-based structural modeling.

These resources collectively enable researchers to place SHCBP1 within its functional context, identify potential interacting partners, and generate hypotheses regarding its role in cellular processes and disease states .

What are common challenges in working with recombinant SHCBP1 and how can they be addressed?

Researchers working with recombinant SHCBP1 may encounter several technical challenges that can impact experimental outcomes. Here are methodological solutions to address these issues:

• Protein Solubility Issues:

  • Challenge: SHCBP1 may form aggregates after reconstitution.

  • Solution: Optimize buffer conditions by testing different pH ranges (6.5-8.0) and including stabilizing agents such as 5-10% glycerol, 0.1% Triton X-100, or 1-5 mM DTT to maintain protein in solution.

• Activity Loss During Storage:

  • Challenge: Diminished functional activity after storage.

  • Solution: Store in small single-use aliquots with 50% glycerol at -80°C. For longer-term preservation, lyophilization with appropriate cryoprotectants may preserve activity better than solution storage.

• Tag Interference:

  • Challenge: Protein tags may interfere with SHCBP1 function in certain assays.

  • Solution: Consider tag-free versions or enzymes for tag removal (TEV protease, thrombin) when functional studies are planned. Alternatively, validate that the tag position (N or C-terminal) minimally impacts function.

• Reconstitution Difficulties:

  • Challenge: Incomplete protein resolubilization from lyophilized state.

  • Solution: Reconstitute slowly at reduced temperatures (4°C) with gentle agitation rather than vortexing. Consider gradual dilution protocols to prevent precipitation.

• Batch-to-Batch Variability:

  • Challenge: Inconsistent activity between protein preparations.

  • Solution: Implement activity assays to normalize across batches, and consider single-batch procurement for critical experimental series.

These methodological solutions derive from established protein biochemistry principles and are applicable to recombinant SHCBP1 work across various experimental contexts .

How can researchers optimize SHCBP1 knockdown efficiency in Xenopus models?

Optimizing SHCBP1 knockdown in Xenopus models requires methodological refinements specific to this model organism:

• Delivery Method Selection:

  • For cell culture: Lentiviral transduction has shown superior efficiency compared to lipid-based transfection for Xenopus cell lines.

  • For embryos: Microinjection of morpholinos or CRISPR/Cas9 components at 1-2 cell stage provides most consistent results.

• Target Sequence Optimization:

  • Design multiple shRNAs targeting different regions of SHCBP1 mRNA.

  • The validated sequence "CCGGCGAGGAAGTAAGGAAGGGAATCTCGAGATTCCCTTCCACTTCTCCGTTTTTG" has demonstrated effectiveness in previous studies.

  • For CRISPR approaches, use Xenopus-specific gRNA design tools that account for genome specificities.

• Knockdown Verification Protocol:

  • RT-PCR primers: Use Xenopus-specific primers:
    Forward: 5′-GCTACCGTGATAAACCAGGTTC-3′
    Reverse: 5′-AGGCTCTGAATCGCTCATAGA-3′

  • Include time-course analysis (24h, 48h, 72h post-transduction) to identify optimal assessment timepoint.

  • Complement RNA analysis with protein detection when antibodies are available.

• Controls Implementation:

  • Include non-targeting shRNA controls that match GC content of the SHCBP1-targeting construct.

  • For developmental studies, include lineage tracers to distinguish cell-autonomous effects.

• Dosage Calibration:

  • Establish dose-response relationships by testing multiple MOIs (multiplicity of infection) or morpholino concentrations.

  • Balance knockdown efficiency against potential off-target or toxic effects.

These methodological refinements have been shown to significantly improve knockdown efficiency in Xenopus models while minimizing experimental variability .

What are emerging areas of investigation regarding SHCBP1 function in development and disease?

Several promising research directions are emerging in the study of SHCBP1's role in development and disease:

• Neural Regeneration Mechanisms:

  • Investigation of SHCBP1's specific role in the metabolic shift during spinal cord regeneration in Xenopus laevis.

  • Exploring whether SHCBP1-mediated metabolic regulation can be harnessed to enhance regenerative capacity in mammals.

  • Understanding how SHCBP1 interfaces with the mTOR pathway during neural stem progenitor cell proliferation and differentiation.

• Cancer Therapeutics Development:

  • Evaluation of SHCBP1 as a potential therapeutic target in tumors with elevated expression.

  • Development of small molecule inhibitors targeting SHCBP1-mediated signaling.

  • Investigation of combination therapies targeting both SHCBP1 and related oncogenic pathways.

• Metabolic Regulation:

  • Elucidation of SHCBP1's direct role in glycolytic enzyme regulation.

  • Investigation of how SHCBP1 contributes to metabolic plasticity in different cellular contexts.

  • Understanding the relationship between SHCBP1 and mitochondrial dynamics during cell fate decisions.

• Developmental Biology:

  • Characterization of SHCBP1 function in embryonic development across model organisms.

  • Exploration of its role in stem cell maintenance and differentiation during organogenesis.

  • Investigation of potential evolutionary conservation of SHCBP1 functions across species.

• Multi-omics Integration:

  • Application of integrated proteomics, metabolomics, and transcriptomics to build comprehensive models of SHCBP1 function.

  • Development of computational approaches to predict SHCBP1 activity based on multi-omics signatures.

These emerging research areas represent fertile ground for novel discoveries regarding SHCBP1 function and its potential applications in regenerative medicine and disease treatment .