RGT1 Antibody

Shipped with Ice Packs
In Stock

Description

Definition and Function of RGT1 Antibody

The RGT1 antibody specifically targets the Rgt1 protein, a zinc-finger transcription factor that regulates hexose transporter (HXT) genes in response to glucose availability . It is frequently engineered as a hemagglutinin (HA)-tagged variant for immunoprecipitation and chromatin immunoprecipitation (ChIP) assays . Key applications include:

  • DNA-binding studies: Detecting Rgt1's association with promoters like HXK2 and HXT1-4 under varying glucose conditions .

  • Phosphorylation analysis: Monitoring glucose-induced hyperphosphorylation, which triggers Rgt1 dissociation from DNA .

  • Protein interaction mapping: Identifying complexes with Med8, Ssn6-Tup1, Mth1, and Std1 .

DNA Binding Dynamics

Rgt1 binds cooperatively to multiple CGG-containing motifs in HXT promoters, as shown by ChIP and electrophoretic mobility shift assays (EMSA) . For example:

  • In low glucose, Rgt1 occupies the HXK2 promoter at the −395 bp RGT1 element .

  • Dissociation from HXT1-4 promoters occurs upon glucose addition, correlating with Rgt1 hyperphosphorylation .

Regulatory Interactions

Interaction PartnerRole in Rgt1 RegulationCitation
Ssn6-Tup1Corepressor complex enabling Rgt1-mediated repression
Mth1/Std1Facilitates Rgt1-DNA binding; degraded via Grr1 in high glucose
Med8Co-binds to HXK2 promoter under glucose-depleted conditions

Phosphorylation and Localization

  • Glucose induces Grr1-dependent phosphorylation, causing Rgt1 nuclear export and loss of DNA binding .

  • Mutations in GRR1 or MTH1 block phosphorylation and sustain promoter association .

Primer Sequences for ChIP Assays

Primers used to amplify Rgt1-bound regions in HXK2 promoter studies :

Target RegionPrimer PairSequence (5’→3’)
Upstream (−395 bp)OL3 + OL4ACTACGAGTTTTCTGAACCTCC / TAATTTCGTGGATCTCGAATC
Downstream (DRS)OL5 + OL6GGAATTGATGCAACAAATTGAG / GATTGAGTGGTGTCAAAGGTAC

Plasmid Constructs for DNA-Binding Studies

Representative plasmids used to analyze Rgt1 binding sites :

PlasmidRgt1 Binding SitesCloning Method
pBM4305Single site (A)Oligo annealing
pBM4317Five sites (A–D)PCR amplification
pBM4335Four sitesOligo annealing

Functional Domains of Rgt1 Identified via Antibody-Based Studies

  • Repression domain (aa 210–250): Binds Ssn6-Tup1 corepressor .

  • Mth1-binding region (aa 310–360): Required for promoter recruitment .

  • Autoinhibitory region (aa 520–830): Blocks DNA binding unless phosphorylated .

Critical Insights from Mutant Analyses

  • Δgrr1 mutants: Fail to phosphorylate Rgt1, leading to sustained promoter binding and HXT repression .

  • Δmth1 mutants: Exhibit constitutive Rgt1 dissociation and HXT derepression, independent of glucose .

  • Δssn6 mutants: Rgt1 binds DNA but cannot repress transcription, confirming Ssn6-Tup1’s essential role .

Product Specs

Buffer
**Preservative:** 0.03% Proclin 300
**Constituents:** 50% Glycerol, 0.01M PBS, pH 7.4
Form
Liquid
Lead Time
Made-to-order (14-16 weeks)
Synonyms
RGT1 antibody; SCRG_03981 antibody; Glucose transport transcription regulator RGT1 antibody; Restores glucose transport protein 1 antibody
Target Names
RGT1
Uniprot No.

Target Background

Function
RGT1 is a glucose-responsive transcription factor that plays a crucial role in regulating the expression of several glucose transporter (HXT) genes in response to glucose availability. In the absence of glucose, RGT1 acts as a transcriptional repressor, while high glucose concentrations trigger its function as a transcriptional activator. In cells growing on low glucose levels, RGT1 adopts a neutral role, neither repressing nor activating transcription. RGT1 binds to the consensus binding site sequence 5'-CGGANNA-3', which is present in multiple copies within the promoters of all HXT genes under its control.
Protein Families
EDS1/RGT1 family
Subcellular Location
Nucleus. Cytoplasm.

Q&A

What is Rgt1 and why are Rgt1 antibodies important in yeast research?

Rgt1 (Restores Glucose Transport 1) is a C₆ zinc cluster transcription factor in Saccharomyces cerevisiae that regulates expression of HXT genes encoding glucose transporters. Rgt1 functions primarily as a transcriptional repressor in the absence of glucose but can act as an activator under high glucose conditions (>2%) .

Rgt1 antibodies are essential tools for investigating glucose-responsive gene regulation because they allow researchers to:

  • Track Rgt1 protein levels in different growth conditions

  • Determine Rgt1's phosphorylation status, which correlates with its regulatory activity

  • Detect Rgt1's association with specific DNA promoter regions using chromatin immunoprecipitation

  • Study protein-protein interactions between Rgt1 and co-repressors like Ssn6 and Tup1

Without specific antibodies against Rgt1, it would be extremely difficult to characterize its biochemical properties and regulatory mechanisms in response to changing glucose levels .

How are Rgt1 antibodies used in chromatin immunoprecipitation experiments?

Chromatin immunoprecipitation (ChIP) with Rgt1 antibodies allows researchers to determine whether and under what conditions Rgt1 binds to HXT gene promoters. The standard protocol involves:

  • Growing yeast cells under specific conditions (e.g., galactose, low glucose, or high glucose)

  • Cross-linking DNA-protein complexes with formaldehyde

  • Lysing cells and shearing chromatin

  • Immunoprecipitating Rgt1-bound DNA fragments using anti-Rgt1 antibody and Protein A-agarose beads

  • Reversing cross-links and purifying DNA

  • Amplifying promoter regions of interest (e.g., HXT1, HXT3, HXT4) by PCR

As demonstrated in multiple studies, this technique has revealed that Rgt1 associates with HXT promoters in galactose-grown cells but dissociates in response to high glucose, correlating with the induction of HXT gene expression . For instance, Kim et al. (2003) successfully amplified HXT1 promoter sequences using primers OM 2642 and OM 2643 after immunoprecipitation with anti-Rgt1 antibodies .

What protein modifications of Rgt1 can be detected using Rgt1 antibodies?

Rgt1 antibodies have been instrumental in identifying glucose-induced phosphorylation as a key regulatory modification. Western blot analysis using anti-Rgt1 antibodies reveals:

  • Rgt1 appears as a polypeptide with an apparent molecular mass of 160 kDa on SDS-polyacrylamide gels, significantly higher than its predicted mass of 132 kDa

  • In glucose-grown cells, Rgt1 migrates with progressively lower mobility as glucose concentration increases

  • Lambda phosphatase treatment restores higher mobility, confirming phosphorylation

  • In galactose-grown cells, Rgt1 is hypophosphorylated

  • In high glucose conditions, Rgt1 becomes hyperphosphorylated

These observations were made using Rgt1-HA tagged protein and anti-HA antibodies, but similar experiments can be conducted with native Rgt1 using anti-Rgt1 antibodies. Importantly, the hyperphosphorylation of Rgt1 correlates with its dissociation from HXT promoters and induction of HXT gene expression .

How does glucose concentration affect Rgt1 binding to HXT promoters as detected by Rgt1 antibodies?

ChIP experiments using Rgt1 antibodies have revealed a glucose concentration-dependent pattern of Rgt1 binding to different HXT promoters:

Glucose ConcentrationHXT1 PromoterHXT3 PromoterHXT4 Promoter
0% (Galactose)Strong bindingStrong bindingStrong binding
0.2% (Low glucose)Moderate bindingModerate bindingNo binding
4% (High glucose)No bindingNo bindingNo binding

This pattern correlates with the expression levels of these genes:

  • HXT1 and HXT3 are partially induced at low glucose (0.2%) and fully induced at high glucose (4%)

  • HXT4 is fully induced at low glucose (0.2%) but repressed at high glucose (4%) through an Rgt1-independent mechanism

The differential binding patterns suggest that Rgt1 is regulated differently at each promoter, with Rgt1 dissociating from promoters under conditions where transcription is induced .

What information can be gained from studying Rgt1 in different genetic backgrounds?

Rgt1 antibodies enable comparative studies of Rgt1 function in various mutant strains, providing insights into the glucose sensing and signaling pathway:

In wild-type cells:

  • Glucose induces Rgt1 hyperphosphorylation and dissociation from HXT promoters

In grr1Δ mutants:

  • Rgt1 remains hypophosphorylated and bound to HXT promoters regardless of glucose presence

  • HXT genes fail to be induced in response to glucose

In mth1Δ mutants:

  • Rgt1 binding to HXT promoters is substantially reduced, especially at the HXT3 promoter

  • HXT3 and HXT4 are derepressed even in the absence of glucose

In std1Δ mutants:

  • Rgt1 binding to promoters remains robust in galactose

  • HXT1 shows defects in repression

In mth1Δ std1Δ double mutants:

  • Rgt1 binding to all HXT promoters is fully disrupted

  • Rgt1 is hyperphosphorylated regardless of glucose presence

  • All HXT genes are derepressed

These findings demonstrate that Rgt1 antibodies are vital tools for elucidating the regulatory mechanisms controlling glucose transporter expression in yeast.

How can researchers optimize Rgt1 antibody specificity for chromatin immunoprecipitation studies?

Optimizing Rgt1 antibody specificity for ChIP studies requires careful consideration of several factors:

  • Antibody validation: Confirm antibody specificity using rgt1Δ strains as negative controls. A properly specific antibody should show no signal in immunoprecipitation from these strains.

  • Cross-linking conditions: Optimize formaldehyde concentration (typically 1%) and cross-linking duration (usually 10-20 minutes) to preserve protein-DNA interactions without creating excessive cross-links that might interfere with immunoprecipitation.

  • Sonication parameters: Adjust sonication conditions to generate chromatin fragments of 200-600 bp, which is optimal for ChIP experiments. Excessive sonication may denature epitopes recognized by the antibody.

  • Blocking conditions: Use proper blocking agents to reduce background. For Rgt1 ChIP experiments, Protein A-agarose beads pre-incubated with BSA and salmon sperm DNA have been successfully used .

  • Controls: Include negative controls (non-specific IgG) and positive controls (antibodies against general transcription factors) in each experiment.

  • Quantification method: For precise quantification of Rgt1 binding, consider using quantitative PCR rather than conventional PCR for analyzing immunoprecipitated DNA .

Researchers have successfully used these approaches to demonstrate that Rgt1 dissociates from HXT promoters in response to glucose, consistent with its role as a transcriptional repressor that is inactivated by glucose .

What methodologies can distinguish between phosphorylated and non-phosphorylated forms of Rgt1?

Distinguishing between phosphorylated and non-phosphorylated forms of Rgt1 requires specialized techniques:

  • Phosphatase treatment experiments: Immunoprecipitate Rgt1 using anti-Rgt1 antibodies and treat with lambda phosphatase with or without phosphatase inhibitors. Compare mobility shifts on SDS-PAGE followed by Western blotting. As demonstrated in previous studies, phosphatase treatment increases the mobility of glucose-grown Rgt1 to resemble that of galactose-grown Rgt1 .

  • Phospho-specific antibodies: While not mentioned in the search results, developing phospho-specific antibodies against key phosphorylation sites of Rgt1 would allow direct detection of phosphorylated forms without requiring phosphatase treatment.

  • Phos-tag SDS-PAGE: This modified SDS-PAGE technique incorporates Phos-tag molecules that specifically bind phosphorylated proteins, causing greater mobility shifts for phosphorylated forms compared to standard SDS-PAGE.

  • Mass spectrometry: For identifying specific phosphorylation sites, immunoprecipitate Rgt1 with anti-Rgt1 antibodies and analyze by mass spectrometry after tryptic digestion.

  • 2D gel electrophoresis: Separating proteins first by isoelectric point and then by molecular weight can resolve different phosphorylated forms of Rgt1.

These methods have revealed that Rgt1 is hyperphosphorylated in response to glucose, and this phosphorylation correlates with its dissociation from HXT promoters and derepression of HXT gene expression .

How do Rgt1 antibodies help elucidate the mechanistic relationship between Grr1, Mth1, Std1, and Rgt1?

Rgt1 antibodies have been instrumental in establishing the regulatory pathway connecting Grr1, Mth1, Std1, and Rgt1:

  • Protein stability assays: Using Rgt1 antibodies in Western blot analysis of strains with various combinations of grr1Δ, mth1Δ, and std1Δ mutations has revealed that:

    • Grr1 is required for glucose-induced degradation of Mth1 and Std1

    • Mth1 and Std1 inhibit glucose-induced phosphorylation of Rgt1

  • ChIP experiments: Anti-Rgt1 antibodies in ChIP experiments across different genetic backgrounds have shown that:

    • In grr1Δ mutants, Rgt1 remains bound to HXT promoters regardless of glucose presence

    • In mth1Δ std1Δ double mutants, Rgt1 fails to bind HXT promoters even in the absence of glucose

    • In mth1Δ grr1Δ double mutants, Rgt1 still dissociates from HXT promoters in response to glucose, indicating Grr1 acts through Mth1

  • Phosphorylation analysis: Western blots with Rgt1 antibodies have demonstrated that:

    • In grr1Δ, Rgt1 remains hypophosphorylated even in high glucose

    • In mth1Δ std1Δ, Rgt1 is constitutively hyperphosphorylated

These findings have established a mechanistic model where:

  • Glucose triggers Grr1-dependent degradation of Mth1 and Std1

  • Loss of Mth1 and Std1 allows hyperphosphorylation of Rgt1

  • Hyperphosphorylated Rgt1 dissociates from HXT promoters, relieving repression

  • HXT genes are induced in response to glucose

What experimental approaches can resolve contradictions in Rgt1 functional data?

Contradictions in Rgt1 functional data, particularly regarding its role as a repressor versus activator, can be resolved through several experimental approaches using Rgt1 antibodies:

  • Comparing protein binding with gene expression: Correlate Rgt1 occupancy at promoters (detected by ChIP with Rgt1 antibodies) with HXT gene expression (measured by RNA analysis) across multiple conditions:

ConditionRgt1 Binding to HXT1HXT1 ExpressionInterpretation
GalactoseStrongLowRepressor function
Low glucose (0.2%)ModerateModeratePartial derepression
High glucose (4%)NoneHighComplete derepression
  • Domain mapping experiments: Create Rgt1 mutants with modifications in potential activation or repression domains and analyze their function using Rgt1 antibodies in:

    • ChIP to assess promoter binding

    • Co-immunoprecipitation to identify interacting partners

    • Western blotting to determine phosphorylation status

  • Protein-protein interaction studies: Use Rgt1 antibodies for co-immunoprecipitation experiments to identify interactions with:

    • Repressors (Ssn6-Tup1) in low glucose

    • Activators (potentially components of mediator or SAGA complexes) in high glucose

  • Analysis of Rgt1 mutations: Examine Rgt1 variants with altered phosphorylation sites to determine how phosphorylation affects its repressor versus activator functions.

The search results suggest that while earlier studies proposed Rgt1 functions as an activator at HXT promoters in high glucose based on reporter fusion and one-hybrid analysis, ChIP experiments with Rgt1 antibodies demonstrate that Rgt1 is absent from these promoters under inducing conditions. This indicates that HXT gene expression occurs as a consequence of Rgt1 dissociation rather than Rgt1-mediated activation .

What are potential applications of Rgt1 antibodies beyond studying glucose transport in yeast?

Rgt1 antibodies have applications extending beyond their primary use in studying glucose transport in yeast:

  • Comparative studies across yeast species: Rgt1 antibodies that recognize conserved epitopes can be used to compare glucose sensing mechanisms across different yeast species, providing evolutionary insights into nutrient adaptation.

  • Bioprocess optimization: In industrial fermentation, monitoring Rgt1 activity using specific antibodies can help optimize glucose feeding strategies for recombinant protein or metabolite production in yeast.

  • Screening for glucose sensing modulators: Rgt1 antibodies can be used in high-throughput screens to identify compounds that affect glucose sensing pathways, potentially leading to new antifungal approaches targeting metabolic regulation.

  • Model system for studying nutrient sensing: As the glucose sensing pathway in yeast shares conceptual similarities with nutrient sensing in higher eukaryotes, studying Rgt1 with specific antibodies provides a model for understanding broader principles of transcriptional regulation in response to nutrients.

  • Development of biosensors: Rgt1 antibodies could be incorporated into biosensor designs that report on cellular glucose status in real-time by detecting Rgt1 phosphorylation or localization changes.

  • Teaching and research training: Due to their specific binding properties and well-characterized target, Rgt1 antibodies serve as excellent tools for laboratory courses teaching immunoprecipitation, ChIP, and Western blotting techniques.

These extended applications demonstrate the value of developing and optimizing specific antibodies against key transcriptional regulators like Rgt1 for both basic and applied research.

Quick Inquiry

Personal Email Detected
Please use an institutional or corporate email address for inquiries. Personal email accounts ( such as Gmail, Yahoo, and Outlook) are not accepted. *
© Copyright 2025 TheBiotek. All Rights Reserved.