rpl-15 Antibody

What is RPL15 and what are its key structural features?

RPL15 (Ribosomal Protein L15) is a component of the 60S subunit of ribosomes with a molecular mass of approximately 64.4 kilodaltons . The protein contains specific domains that are functionally critical and highly conserved across species. RPL15 plays an essential role in ribosome biogenesis and protein translation processes. Mutations in the RPL15 gene can lead to production of truncated proteins, as seen in mutations like p.Tyr81* and p.Gln29* . The protein's high conservation across species indicates its fundamental importance in cellular function, with orthologs identified in canine, porcine, monkey, mouse and rat models .

How does RPL15 differ from other ribosomal proteins like RRP15?

While RPL15 and RRP15 both have roles in ribosomal function, they represent distinct proteins with different mechanisms of action. RPL15 is a structural component of the ribosome involved in translation, whereas RRP15 is a nucleolar protein critical for ribosome biogenesis (RiBi) and checkpoint control . RRP15 deficiency induces ribosome stress, which inhibits cell proliferation and metastasis via suppressing the Wnt/β-catenin pathway in colorectal cancer . This distinction is important when designing experiments targeting specific ribosomal pathways.

What are the recommended applications for RPL15 antibodies in research?

Based on available commercial antibodies, RPL15 antibodies are suitable for multiple research applications including Western Blot (WB), immunoprecipitation (IP), fluorescence assays (FA), immunohistochemistry (IHC), immunofluorescence (IF), and ELISA . When selecting an antibody, researchers should consider reactivity (human, mouse, rabbit, rat), conjugation type (unconjugated or tagged), and specific validation for their application of interest. For detecting RPL15 in western blotting, antibodies like Abcam #ab130992 have been successfully employed in published research .

How does RPL15 contribute to hepatocellular carcinoma progression?

RPL15 demonstrates significant oncogenic properties in hepatocellular carcinoma (HCC). Research has shown that RPL15 is consistently upregulated in HCC tissues and cell lines compared to normal liver tissue . Mechanistically, RPL15 silencing has been demonstrated to:

• Induce cell cycle arrest in the G1 phase in HCC cells

• Suppress colony formation, proliferation, invasion, and migration

• Induce apoptosis in HCC cells

• Implicate the RPs-MDM2-p53 pathway in oncogenic transformation

Conversely, RPL15 upregulation promotes tumor progression. Immunohistochemical analysis has revealed strong nuclear staining of RPL15 in HCC tissues with minimal staining in normal tissues . This expression pattern correlates with poor prognosis, suggesting RPL15 as a potential therapeutic target and biomarker for HCC.

What mechanisms explain RPL15's role in gastric cancer stem-like properties and chemoresistance?

RPL15 functions through the miR-567/RPL15/TGF-β/Smad axis to affect gastric cancer (GC) stem-like properties and chemoresistance . Research has established that:

• miR-567 directly targets RPL15, as confirmed through luciferase reporter assays

• RPL15 overexpression promotes microsphere formation in gastric cancer cells

• RPL15 upregulation enhances the expression of stem-like marker proteins (SOX2, NANOG, and ALDH1A1)

• RPL15 overexpression significantly promotes growth of cisplatin-resistant AGS/DDP cells

• The TGF-β/Smad pathway inhibitor LY 3200882 significantly inhibits the expression of RPL15, TGF-β1, TGF-R1, p-Smad1, and p-Smad2

This pathway represents a potential therapeutic target for addressing chemoresistance in gastric cancer treatment protocols.

What are the methodological considerations when investigating RPL15 knockdown effects in cancer research?

When investigating RPL15 knockdown effects, researchers should consider several methodological factors:

• Selection of silencing method: RPL15-specific siRNA transfection has been successfully used with Lipofectamine 3000 reagent according to manufacturer protocols .

• Appropriate controls: Include negative control siRNA (siRNA NC) in parallel experiments to control for non-specific effects .

• Verification of knockdown efficiency: Confirm RPL15 silencing using both RT-qPCR and western blot to ensure both mRNA and protein levels are reduced.

• Comprehensive phenotypic analysis: Assess multiple cancer hallmarks including:

  • Cell cycle progression using flow cytometry

  • Apoptosis using Annexin V/PI staining

  • Invasion and migration using transwell assays

  • Proliferation using cell counting or MTT/MTS assays

  • Colony formation using soft agar assays

• Signaling pathway validation: Investigate downstream effects on key pathways such as the RPs-MDM2-p53 and TGF-β/Smad pathways through protein expression analysis .

How are RPL15 mutations associated with Diamond-Blackfan anemia (DBA)?

RPL15 mutations represent a newly identified genetic subgroup of Diamond-Blackfan anemia (DBA) with distinctive clinical features. Research has identified six patients with RPL15 mutations from the EuroDBA registries, which collectively represent 985 patients . The mutations found include:

• c.242dupA mutation (p.Tyr81*) in three unrelated patients

• c.85C>T mutation (p.Gln29*) resulting in early protein truncation

These mutations in RPL15 are associated with an unexpectedly high rate of hydrops fetalis and spontaneous, long-lasting remissions . The Exome Aggregation Consortium (ExAC) reports that RPL15 is highly intolerant to loss-of-function mutations (pLI score = 0.96), with no reported cases in over 60,000 individuals, confirming the likely pathogenicity of these novel mutations .

What experimental approaches are recommended for validating RPL15 mutations in genetic diseases?

When validating RPL15 mutations in genetic disorders, researchers should implement a multi-faceted approach:

• Targeted sequencing: Use Sanger sequencing of RPL15 to identify mutations in patients without established genotypes in known DBA-linked genes .

• Functional validation: Assess the impact of mutations on protein function through:

  • Western blotting to detect truncated proteins

  • Analysis of TP53 pathway activation (phospho-TP53, p21 expression)

  • Evaluation of ribosome biogenesis through northern blotting or polysome profiling

• Patient registry analysis: Compare clinical features across cohorts to identify mutation-specific phenotypes, as demonstrated in the EuroDBA consortium analysis .

• Real-time PCR analysis: Use validated primers for RPL15 expression analysis:

  • TaqMhupRPL15F: CAGCCATCAGGTAAGCCAAGA

  • TaqMhuRPL15R: CAGCGGACCCTCAGAAGAAA

• Protein-protein interaction studies: Investigate interactions between mutant RPL15 and other ribosomal assembly factors to understand pathogenic mechanisms.

How can researchers effectively distinguish between direct and indirect effects of RPL15 dysfunction?

Distinguishing between direct and indirect effects of RPL15 dysfunction requires sophisticated experimental design:

• Rescue experiments: Introduce wild-type RPL15 into RPL15-deficient cells to determine which phenotypes can be rescued, indicating direct effects.

• Temporal analysis: Use inducible knockdown or knockout systems to track the sequence of molecular events following RPL15 depletion.

• Ribosome profiling: Implement ribosome profiling to distinguish between translational and non-translational functions of RPL15.

• Comparative studies: Compare effects of RPL15 dysfunction with other ribosomal protein deficiencies to identify RPL15-specific versus general ribosomal stress responses.

• Protein structure-function studies: Generate specific domain mutations in RPL15 to map functions to particular regions of the protein.

• Pathway inhibitor experiments: Use inhibitors of suspected downstream pathways (like TGF-β/Smad inhibitor LY 3200882) to determine whether phenotypes persist when potential mediating pathways are blocked .

What are the best practices for investigating RPL15 and microRNA interactions?

When investigating RPL15 and microRNA interactions, researchers should follow these best practices:

• Bioinformatic prediction: Use platforms like TargetScan to identify potential microRNA binding sites in the RPL15 3'UTR .

• Luciferase reporter assays: Construct RPL15 3'UTR (wild-type) and RPL15 3'UTR (mutant) plasmids to validate direct interactions. Transfect cells with microRNA mimics (e.g., miR-567) and these constructs to measure luciferase activity after 48 hours .

• Expression correlation analysis: Assess inverse correlation between microRNA and RPL15 expression in patient samples.

• Functional rescue experiments: Determine if phenotypes induced by microRNA overexpression can be rescued by RPL15 re-expression without the 3'UTR.

• Cellular context consideration: Test interactions in multiple cell lines to ensure findings are not cell-type specific.

• In vivo validation: Confirm findings from cell culture in animal models when possible.

What contradictions exist in the current research on RPL15 function across different disease contexts?

Several noteworthy contradictions exist in current RPL15 research that deserve further investigation:

• Tissue-specific effects: RPL15 shows opposite expression patterns in different cancers - upregulated in hepatocellular carcinoma and some gastric cancers , but sharply decreased in skin squamous cell carcinoma and pancreatic cancer .

• Dual roles in development and disease: RPL15 mutations cause developmental disorders like Diamond-Blackfan anemia , while its overexpression promotes cancer progression , suggesting context-dependent functions.

• Mechanism discrepancies: Different studies implicate distinct pathways in RPL15-mediated effects:

  • RPs-MDM2-p53 pathway in hepatocellular carcinoma

  • miR-567/TGF-β/Smad axis in gastric cancer

• Therapeutic implications: The apparent oncogenic role of RPL15 in some cancers contrasts with its essential developmental role, raising questions about targeting strategies that would minimize adverse effects.

These contradictions highlight the need for integrated research approaches that consider tissue context, developmental stage, and disease-specific molecular environments.

What validation steps are essential before using a new RPL15 antibody in research?

Before implementing a new RPL15 antibody in research, the following validation steps are essential:

• Specificity testing:

  • Western blot analysis using positive controls (RPL15-expressing cells) and negative controls (RPL15-knockdown cells)

  • Immunoprecipitation followed by mass spectrometry to confirm target identity

  • Peptide competition assay to verify epitope specificity

• Application-specific validation:

  • For IHC: Test on known positive and negative tissues with appropriate controls

  • For IF: Verify subcellular localization patterns match known distribution

  • For flow cytometry: Confirm signal separation between positive and negative populations

• Cross-reactivity assessment: Test on tissues from different species if planning cross-species applications.

• Lot-to-lot consistency: Compare new lots to previously validated lots if conducting longitudinal studies.

• Reproducibility assessment: Verify consistent results across multiple experimental repeats and between different researchers.

How should researchers troubleshoot non-specific binding when using RPL15 antibodies?

When encountering non-specific binding with RPL15 antibodies, implement this systematic troubleshooting approach:

• Optimization of blocking conditions:

  • Test different blocking reagents (BSA, milk, commercial blockers)

  • Increase blocking time or concentration

  • Add protein from the host species of secondary antibody to blocking buffer

• Antibody dilution optimization:

  • Test serial dilutions to find optimal concentration

  • Consider longer incubation at lower concentrations

• Buffer modification:

  • Add detergents (0.1-0.3% Triton X-100 or Tween-20)

  • Adjust salt concentration to increase stringency

  • Add carrier proteins to reduce non-specific interactions

• Sample preparation improvements:

  • Optimize fixation protocols for IHC/IF

  • Ensure complete protein denaturation for Western blot

  • Consider antigen retrieval methods for fixed tissues

• Secondary antibody considerations:

  • Use highly cross-adsorbed secondary antibodies

  • Reduce secondary antibody concentration

  • Consider directly conjugated primary antibodies to eliminate secondary reactions

• Null controls:

  • Include isotype controls matched to primary antibody

  • Use tissue/cells with confirmed absence of target protein

What experimental design factors should be considered when using RPL15 antibodies in complex disease models?

When using RPL15 antibodies in complex disease models, several experimental design factors require careful consideration:

• Appropriate controls:

  • Include healthy tissue controls alongside disease samples

  • Use genetic models with confirmed RPL15 alteration as positive controls

  • Implement isotype controls to account for non-specific binding

• Sample handling and preparation:

  • Standardize collection, fixation, and storage protocols

  • Consider the impact of disease state on tissue morphology and accessibility

  • Optimize antigen retrieval for disease-specific tissue changes

• Quantification methods:

  • Establish objective scoring systems for IHC/IF

  • Use digital image analysis with consistent thresholds

  • Include multiple observers for manual scoring to reduce bias

• Heterogeneity consideration:

  • Sample multiple regions within tissues to account for heterogeneity

  • Consider single-cell approaches when bulk analysis may mask important differences

  • Correlate RPL15 expression with specific cell types using co-staining

• Longitudinal considerations:

  • Track expression changes over disease progression

  • Implement consistent staining protocols across timepoints

  • Consider batch effects in long-term studies

• Therapeutic response monitoring:

  • Assess RPL15 expression before and after therapeutic intervention

  • Correlate changes with clinical outcomes

  • Consider pharmacodynamic effects on antibody binding