RNASE4 Antibody

What is RNASE4 and why is it important in research?

RNASE4 (Ribonuclease A family member 4) is a 16.8 kilodalton protein that preferentially cleaves after uridine bases . It has garnered research interest due to its diverse roles in cancer progression, antimicrobial defense, and inflammatory conditions. RNASE4 has been associated with aggressive prostate cancer, with plasma levels correlating with disease stage, grade, and Gleason score . Additionally, it functions as an antimicrobial protein in the urinary tract with activity against uropathogenic E. coli (UPEC) , and in the intestine where it regulates microbiota and metabolite homeostasis .

What types of RNASE4 antibodies are available for research?

Various RNASE4 antibodies are available for research applications. These include:

• Unconjugated antibodies for applications like western blot, immunohistochemistry, and immunofluorescence

• Antibodies with reactivity to human, mouse, rat, or monkey RNASE4

• Monoclonal and polyclonal antibodies for different experimental needs

The selection depends on your specific application, species of interest, and desired sensitivity. For instance, the antibody ab214293 from Abcam is a rabbit polyclonal antibody suitable for immunohistochemistry on paraffin-embedded tissues (IHC-P) .

How do I validate the specificity of an RNASE4 antibody?

Proper validation is crucial for ensuring antibody specificity. Methodological approaches include:

• Blocking peptide competition assay: Incubate 100-fold molar excess of synthetic human RNASE4 peptide with primary anti-RNASE4 antibody for 60 minutes at room temperature before application to samples .

• Western blot analysis: Verify a single band at the expected molecular weight (approximately 16.8 kDa).

• Comparison with genetic knockdown: Use RNASE4-specific shRNA to reduce expression and confirm corresponding reduction in antibody signal. Specific shRNA sequences that have been validated include:

  • ShRNASE4-1: CCGGGAGCACTAGACGTGTTGTCATCTCGAGATGACAACACGTCTAGTGCTCTTTTTG

  • ShRNASE4-2: CCGGTGATCGCTACTGCAACTTGATCTCGAGATCAAGTTGCAGTAGCGATCATTTTTG

• Positive and negative control tissues based on known expression patterns.

What are the recommended protocols for immunohistochemistry with RNASE4 antibodies?

For immunohistochemistry (IHC) on formalin-fixed paraffin-embedded tissues:

• Deparaffinize and rehydrate tissue sections following standard procedures

• Perform antigen retrieval (method may vary depending on antibody)

• Block endogenous peroxidase with hydrogen peroxide

• Apply primary RNASE4 antibody at recommended dilution (e.g., 1:50-1:100 for ab214293) and incubate overnight at 4°C

• Apply appropriate secondary antibody and detection system

• Counterstain, dehydrate, and mount

For validation of results, consider using a blocking peptide competition assay as a negative control as described in search result #3 .

How can I detect RNASE4 expression at the mRNA level?

Several approaches have been validated for detecting RNASE4 at the mRNA level:

• Quantitative Real-Time PCR:

  • Isolate RNA using a standard kit (e.g., RNeasy Plus Mini Kit)

  • Synthesize cDNA (e.g., using Verso cDNA Synthesis Kit)

  • Perform qPCR using validated primers:

    • Forward: 5′-TTGGAAGAGATGGTGATGGGC-3′

    • Reverse: 5′-GTATCTTAGAGGTGCCTGGAGT-3′

  • Normalize to standard curves generated from serial dilutions of gene-specific plasmids

• RNAscope In Situ Hybridization:

  • Use RNAscope Chromogenic Assay following manufacturer's protocol

  • Pretreat samples with hydrogen peroxide, target retrieval solution, and Protease Plus

  • Hybridize with custom RNASE4-C1 probe

  • Use RNAscope 2.5 High Definition-Red Assay for detection

  • Counterstain with 50% Gill's hematoxylin I

What are the appropriate methods for analyzing RNASE4 protein in biological fluids?

For detecting RNASE4 in biological fluids such as urine, plasma, or stool samples:

• For urine or other dilute fluids:

  • Concentrate samples using Amicon Ultra-4 Centrifugal Filter Devices

  • Quantify using Western blot or ELISA methods

• For plasma:

  • Direct analysis via immunoassay methods has been validated for prostate cancer biomarker studies

• For stool samples:

  • Extract proteins from stool

  • Detect RNASE4 via immunoblotting as demonstrated in intestinal research

When analyzing RNASE4 in biological fluids, controls are critical as concentration levels may correlate with disease states. For instance, urinary RNASE4 concentrations were found to be significantly lower in females with a history of urinary tract infection compared to healthy controls .

How can RNASE4 antibodies be used to investigate cancer pathogenesis?

RNASE4 antibodies have proven valuable in cancer research, particularly for:

• Biomarker studies:

  • Analyzing RNASE4 expression in tumor tissues via IHC

  • Measuring RNASE4 levels in plasma as a potential diagnostic marker (elevated in prostate cancer and correlates with disease stage)

• Mechanistic studies:

  • Investigating RNASE4's role in activating AXL and AKT signaling pathways in cancer cells

  • Studying effects on epithelial-mesenchymal transition (EMT) in glioblastoma

• Therapeutic potential:

  • Evaluating RNASE4-specific monoclonal antibodies as therapeutic agents (shown to inhibit xenograft prostate cancer growth)

  • Investigating RNASE4 inhibition to enhance sensitivity to chemotherapeutic agents like temozolomide (TMZ) in glioblastoma

What methods can be used to study RNASE4's antimicrobial functions?

To investigate RNASE4's antimicrobial properties:

• Bacterial growth inhibition assays:

  • Treat bacteria (e.g., uropathogenic E. coli or Parasutterella) with recombinant RNASE4

  • Monitor growth via optical density measurements

  • Determine minimum inhibitory concentration (MIC)

• Membrane integrity assays:

  • Use propidium iodide staining to assess bacterial membrane permeabilization following RNASE4 treatment

  • Employ immunofluorescence staining to visualize RNASE4 binding to bacterial membranes

• Functional neutralization:

  • Neutralize RNASE4 in human urine using specific antibodies

  • Assess changes in bacterial replication or attachment to urothelial cells

• In vivo models:

  • Use RNASE4-deficient mice to study susceptibility to infections or inflammatory conditions

How can I investigate contradictory findings regarding RNASE4 functions in different tissues?

RNASE4 exhibits diverse and sometimes context-dependent functions. To investigate contradictory findings:

• Tissue-specific expression analysis:

  • Compare RNASE4 expression levels across tissues using qPCR and immunoblotting

  • Identify tissue-specific isoforms or post-translational modifications

• Conditional knockout models:

  • Generate tissue-specific RNASE4 knockout mice to isolate its function in specific organs

• Protein interaction studies:

  • Identify tissue-specific binding partners through co-immunoprecipitation followed by mass spectrometry

  • Compare interactomes between tissues with divergent RNASE4 functions

• Functional domain mapping:

  • Utilize different antibodies recognizing distinct epitopes to determine if structural features contribute to functional differences

  • Create domain-specific mutants to isolate functions

What are common technical issues when working with RNASE4 antibodies and how can they be resolved?

How can I optimize experiments to detect low levels of RNASE4 in clinical samples?

For enhanced sensitivity in detecting low RNASE4 levels:

• Sample preparation:

  • Concentrate biological fluids using centrifugal filters

  • Optimize protein extraction from tissues with specialized buffers

  • Consider immunoprecipitation to enrich RNASE4 before analysis

• Signal amplification:

  • Use tyramide signal amplification (TSA) for IHC applications

  • Employ highly sensitive chemiluminescent substrates for Western blots

  • Consider digital droplet PCR for low mRNA detection

• Quantification methods:

  • Develop a standard curve using recombinant RNASE4

  • Use advanced imaging techniques with background correction

  • Consider multiplexed assays to normalize against housekeeping proteins

How do I reconcile data from antibody-based detection methods with functional assays?

When antibody-based detection and functional assays yield different results:

• Assess antibody epitope location:

  • Determine if the epitope is within a functional domain of RNASE4

  • Use multiple antibodies targeting different regions of the protein

• Consider post-translational modifications:

  • Antibodies may detect total protein while function depends on specific modifications

  • Employ modification-specific antibodies (phospho-specific, etc.)

• Evaluate protein-protein interactions:

  • Native complexes may mask epitopes or alter function

  • Use native vs. denaturing conditions in parallel experiments

• Validate with orthogonal methods:

  • Combine antibody detection with recombinant protein studies

  • Use genetic approaches (knockdown/knockout) alongside antibody-based methods

How can RNASE4 antibodies be used to study its role in inflammatory bowel disease (IBD)?

Recent research has implicated RNASE4 in IBD pathogenesis:

• Expression analysis in patient samples:

  • Compare RNASE4 levels in intestinal tissues and stool samples from IBD patients versus healthy controls

  • Correlate RNASE4 levels with disease severity and microbiome composition (particularly Parasutterella abundance)

• Mechanistic studies:

  • Investigate how RNASE4 regulates intestinal microbiota

  • Study its impact on indoleamine-2,3-dioxygenase 1 (IDO1) expression and kynurenic/xanthurenic acid production in intestinal epithelial cells

• Therapeutic potential:

  • Evaluate recombinant RNASE4 as a therapeutic agent to modulate gut microbiota

  • Assess its potential as a biomarker for IBD diagnosis or prognosis

What are the latest methods to study RNASE4's role in chemoresistance mechanisms?

To investigate RNASE4's role in chemoresistance, particularly in glioblastoma:

• Chemosensitivity assays:

  • Manipulate RNASE4 expression using knockdown or overexpression approaches

  • Assess changes in cancer cell sensitivity to chemotherapeutic agents like temozolomide

  • Measure cell viability, apoptosis, and DNA damage response

• Signaling pathway analysis:

  • Investigate RNASE4's effect on key resistance pathways:

    • AXL/AKT activation

    • NF-κB signaling

    • Expression of inhibitors of apoptosis proteins (IAPs) including cIAP1, cIAP2, and SURVIVIN

• Combination therapy approaches:

  • Test RNASE4 inhibition in combination with SURVIVIN inhibitors (e.g., YM-155)

  • Assess synergistic effects on restoring chemosensitivity

Researchers have found that RNASE4 can contribute to temozolomide resistance by activating NF-κB through IκBα phosphorylation and degradation, leading to upregulation of anti-apoptotic proteins like SURVIVIN .

What novel applications of RNASE4 antibodies are emerging in cancer research?

Emerging applications include:

• Liquid biopsy development:

  • Detection of circulating RNASE4 as a non-invasive biomarker for cancer diagnosis and monitoring

• Targeted therapy approaches:

  • Development of antibody-drug conjugates targeting RNASE4

  • Combination of RNASE4 antibodies with checkpoint inhibitors

• Predictive biomarker:

  • Stratification of patients for personalized treatment approaches based on RNASE4 expression

  • Prediction of treatment response to specific chemotherapeutic agents

How might antibody engineering enhance RNASE4 research and therapeutic applications?

Advanced antibody engineering approaches might include:

• Development of bispecific antibodies:

  • Targeting RNASE4 and key signaling molecules simultaneously

  • Enhancing immune cell recruitment to RNASE4-expressing tumors

• Antibody fragments:

  • Creating smaller antibody formats (Fab, scFv) for improved tissue penetration

  • Enhancing delivery across barriers (e.g., blood-brain barrier for glioblastoma)

• Intrabodies:

  • Developing cell-penetrating antibodies to inhibit intracellular RNASE4 functions

  • Targeting specific subcellular pools of RNASE4

• Conditional activation:

  • Creating antibodies that become active only in specific microenvironments (e.g., tumor hypoxia)

  • Reducing off-target effects in normal tissues