RPL23 Antibody

What is RPL23 and why is it a significant research target?

RPL23 (Ribosomal Protein L23) is a component of the 60S ribosomal subunit involved in protein synthesis. It is a 15 kDa protein composed of 140 amino acids that functions in ribosomal assembly and translation. RPL23 has gained significance in research due to its roles beyond protein synthesis, including interactions with the p53 pathway, involvement in cell cycle regulation, and associations with cancer progression . Recent studies have identified RPL23 as having extra-ribosomal functions in cellular stress responses and apoptotic regulation, making it an important target for both basic science and translational research .

What applications are RPL23 antibodies validated for in research protocols?

RPL23 antibodies have been validated for multiple research applications with specific performance parameters:

The selection of application should be guided by experimental objectives and sample types, with appropriate controls to validate specificity .

How should researchers optimize storage conditions for RPL23 antibodies?

Most commercially available RPL23 antibodies require specific storage protocols to maintain activity:

• Store at -20°C in aliquots to minimize freeze-thaw cycles (stable for one year from receipt)

• Use storage buffers containing PBS with 0.02% sodium azide and 50% glycerol at pH 7.3

• Avoid repeated freeze-thaw cycles that can cause antibody degradation and loss of binding capacity

• For working solutions, maintain at 4°C for up to one month with antimicrobial preservatives

• Smaller size antibody preparations (20μL) may contain 0.1% BSA as a stabilizer

Researchers should monitor solution clarity before use, as precipitation may indicate degradation. Centrifugation of the antibody solution before use is recommended if turbidity is observed .

What are the key considerations for validating RPL23 antibody specificity?

Rigorous validation of RPL23 antibody specificity is essential for reliable research outcomes:

• Perform parallel experiments with negative controls (isotype control antibodies) and positive controls (cell lines with known RPL23 expression)

• Validate specificity through multiple techniques (e.g., WB combined with IP or IF)

• Consider cross-reactivity with other ribosomal proteins due to sequence homology

• Include knockout or knockdown validation if possible, as several publications have used this approach for definitive confirmation

• Be aware of species cross-reactivity limitations - while many RPL23 antibodies recognize human, mouse, and rat RPL23, predicted reactivity with other species (zebrafish, bovine, pig) should be experimentally verified

Specificity testing is particularly important when exploring RPL23's extra-ribosomal functions to ensure observed effects are not due to off-target binding .

How can RPL23 antibodies be utilized to investigate its role in cancer progression?

Recent studies have employed RPL23 antibodies to elucidate its involvement in cancer pathogenesis:

• Immunohistochemical analysis of patient-derived samples has revealed differential RPL23 expression between normal and malignant tissues, particularly in epithelial ovarian cancer (EOC)

• Western blot quantification of RPL23 in cisplatin-resistant versus cisplatin-sensitive cancer cells demonstrated significant upregulation in resistant phenotypes

• Researchers can combine RPL23 detection with epithelial-mesenchymal transition (EMT) markers (E-cadherin, N-cadherin, Vimentin) to study RPL23's potential role in metastatic progression

• Multiplex immunofluorescence using RPL23 antibodies alongside cell cycle markers can identify correlations between RPL23 expression and proliferative capacity of tumor cells

• Chromatin immunoprecipitation (ChIP) assays using RPL23 antibodies can elucidate its potential interactions with chromatin and transcriptional regulation in cancer cells

These approaches have contributed to the understanding that RPL23 may serve as a potential therapeutic target and biomarker for cancer progression and treatment resistance .

What methodologies are effective for studying RPL23's interaction with p53 signaling pathways?

To investigate RPL23's role in the p53 pathway, researchers have employed several sophisticated approaches:

• Co-immunoprecipitation using RPL23 antibodies to pull down p53 pathway components, particularly MDM2 and its mutants, has revealed specific binding partners

• Comparative protein expression analysis between wild-type and MDM2-mutant cells (MDM2 C305F) demonstrates differential RPL23 expression and function

• Combination of RPL23 antibodies with RAS pathway inhibitors (MEK, PI3K, mTOR) can elucidate regulatory mechanisms controlling RPL23 expression in oncogenic contexts

• In vivo studies with genetically modified mouse models (p19ARF-deficient, MDM2-mutant) provide insights into RPL23's tumor-suppressive functions through p53 regulation

• RNA immunoprecipitation (RIP) using RPL23 antibodies can identify RNA species involved in RPL23-mediated p53 regulation

Research has shown that RPL23 links oncogenic RAS signaling to p53-mediated tumor suppression, with the MDM2 C305F mutation affecting RPL23-MDM2 interactions in ways that influence cancer progression .

What is the optimal experimental design for studying RPL23's role in chemoresistance?

To investigate RPL23's contribution to chemoresistance, particularly in epithelial ovarian cancer (EOC), researchers should consider this experimental framework:

• Patient stratification: Divide clinical samples into cisplatin-resistant and cisplatin-sensitive groups based on treatment response

• Expression analysis: Perform comparative immunohistochemistry (IHC) and western blotting between resistant and sensitive tumors using validated RPL23 antibodies (dilution 1:1000)

• Functional validation: Conduct RPL23 knockdown studies in resistant cell lines followed by chemosensitivity assays to establish causality

• Mechanistic investigation: Analyze EMT marker expression (E-cadherin, N-cadherin, Vimentin) in relation to RPL23 levels to identify potential regulatory relationships

• Clinical correlation: Create a nomogram prognostic model incorporating RPL23 expression with clinical parameters to predict treatment outcomes

This approach has revealed that higher RPL23 expression significantly correlates with cisplatin resistance (p < 0.05), with 30/37 resistant patients showing high expression versus only 13/51 sensitive patients .

How can researchers effectively study RPL23's role in cellular apoptosis regulation?

To investigate RPL23's function in apoptotic regulation, especially relevant in myelodysplastic syndrome (MDS), the following methodological approach is recommended:

• Expression manipulation: Employ RNA interference techniques to reduce RPL23 expression, followed by viability assessments (MTT, colony formation assays)

• Cell cycle analysis: Combine RPL23 antibodies with flow cytometry to measure G1-S cell cycle distribution changes after RPL23 knockdown

• Transcriptional profiling: Conduct gene microarray analysis comparing RPL23-knockdown and control cells to identify downstream effectors

• Protein interaction studies: Use co-immunoprecipitation with RPL23 antibodies to identify regulatory partners such as Miz-1 and c-Myc

• Clinical validation: Compare RPL23, Miz-1, and c-Myc expression patterns between higher-risk and lower-risk MDS patient samples

This approach has established that reduced RPL23 expression leads to increased apoptosis and G1-S cell cycle arrest through Miz-1-dependent induction of p15Ink4b and p21Cip1, while the RPL23/Miz-1/c-Myc regulatory circuit creates a feedback loop that contributes to apoptotic resistance in higher-risk MDS patients .

What considerations are important when using RPL23 antibodies for nucleocytoplasmic localization studies?

When investigating RPL23's distribution between nuclear and cytoplasmic compartments:

• Subcellular fractionation: Perform differential centrifugation to separate free protein pools from ribosome-containing fractions before immunoprecipitation with RPL23 antibodies

• Immunofluorescence optimization: Use pre-extraction methods to distinguish between free and ribosome-incorporated RPL23, with careful antibody dilution optimization (1:50-1:200)

• Co-localization analysis: Combine RPL23 staining with markers for nucleolus (fibrillarin), nuclear speckles (SC35), and ribosomal assembly sites to track RPL23 trafficking

• Chaperone interaction studies: Investigate RPL23's associations with nuclear chaperones such as Bcp1 through co-immunoprecipitation from nuclear extracts

• RNase treatment controls: Include RNase digestion steps to distinguish RNA-dependent from direct protein-protein interactions

Research with yeast models has demonstrated that Bcp1 serves as a nuclear chaperone for Rpl23, with their interaction detected only in the free protein pool rather than in ribosome-containing fractions, suggesting a pre-ribosomal assembly role .

What protocols should be followed when using RPL23 antibodies for immune infiltration studies in cancer research?

For analyzing relationships between RPL23 expression and tumor immune microenvironment:

• Tissue preparation: Process patient samples with appropriate fixation and antigen retrieval methods optimized for multiplex detection of RPL23 and immune cell markers

• Expression quantification: Use digital pathology tools to score RPL23 expression levels, establishing clear cutoff criteria (e.g., median expression as threshold)

• Immune profiling: Correlate RPL23 expression with immune cell infiltration metrics, stromal scores, and tumor purity assessments

• Bioinformatic integration: Incorporate TCGA database analysis to validate tissue-based findings with larger genomic datasets

• Statistical modeling: Apply appropriate statistical methods (t-tests for immune score comparisons, Kaplan-Meier analysis for survival outcomes)

This methodology has revealed that high RPL23 expression correlates with lower immune scores (p = 2 × 10–5) and higher tumor purity (p = 3.06 × 10–5), potentially influencing tumor microenvironment and treatment response .

What are common issues encountered with RPL23 antibodies and how can they be resolved?

Researchers commonly encounter several technical challenges when working with RPL23 antibodies:

• High background in Western blots: Optimize blocking conditions (5% non-fat milk or BSA) and increase washing stringency with 0.1% Tween-20 in TBS

• Weak or absent signal: Ensure proper antigen retrieval for IHC (TE buffer pH 9.0 is recommended over citrate buffer pH 6.0), and optimize antibody concentration through titration experiments

• Non-specific bands: Validate with positive control lysates (BxPC-3, PC-3, Jurkat, NIH/3T3 cells) that show the expected 15 kDa band

• Poor reproducibility: Standardize lysate preparation methods, particularly when comparing RPL23 expression between normal and cancer cells

• Cross-reactivity concerns: Confirm specificity using knockout/knockdown controls whenever possible, especially when studying closely related ribosomal proteins

When troubleshooting immunoprecipitation experiments, use 0.5-4.0 μg antibody for 1.0-3.0 mg of total protein lysate to achieve optimal pull-down efficiency without non-specific binding .

How should researchers design appropriate controls for RPL23 antibody experiments?

Robust experimental design requires thoughtful implementation of controls:

• Positive controls: Include validated cell lines with known RPL23 expression (SH-SY5Y, 293T, HeLa, HepG2, BxPC-3, PC-3, Jurkat, NIH/3T3 cells)

• Negative controls:

  • Isotype-matched irrelevant antibodies for immunoprecipitation and IHC experiments

  • RPL23 knockdown/knockout samples whenever possible

• Loading controls: Select appropriate housekeeping proteins (β-actin) that do not fluctuate under experimental conditions

• Cross-validation: Confirm key findings using multiple antibodies from different manufacturers or different clones

• Peptide competition assays: Pre-incubate antibody with immunizing peptide to confirm binding specificity, particularly for novel applications

Researchers investigating RPL23 in cancer should include paired normal and tumor tissues from the same patient to account for individual variation in basal expression levels .

What are the critical considerations for quantitative analysis of RPL23 expression?

For accurate quantitative assessment of RPL23 expression:

• Sample preparation standardization: Use consistent protocols for cell lysis and protein extraction to minimize technical variation

• Quantification methods:

  • For Western blots: Use digital imaging systems and densitometry software (e.g., Image J) with appropriate normalization to loading controls

  • For IHC: Implement standardized scoring systems based on staining intensity and percentage of positive cells

• Statistical approach: Apply appropriate statistical methods for comparing expression levels between experimental groups, with sufficient sample sizes to achieve statistical power

• Validation across platforms: Confirm protein expression changes with corresponding mRNA quantification using RT-qPCR with validated primers (F: TCCTCTGGTGCGAAATTCCG, R: CGTCCCTTGATCCCCTTCAC)

• Automated systems consideration: For enhanced reproducibility, consider automated Western blotting platforms like WES for protein separation and detection

Studies of RPL23 in epithelial ovarian cancer employed these methods to reliably demonstrate significant upregulation of both RPL23 protein and mRNA in cisplatin-resistant cells compared to cisplatin-sensitive counterparts .

How should researchers approach species cross-reactivity when working with RPL23 antibodies?

When dealing with RPL23 antibodies across different species:

• Sequence homology assessment: Evaluate the degree of conservation in the immunogen region between target species (human RPL23 shows high conservation with mouse and rat)

• Validation strategy: Test antibody performance in each species of interest separately, even when cross-reactivity is predicted

• Application-specific testing: Cross-reactivity may vary by application; an antibody may work for WB but not IHC in the same species

• Positive control selection: Use species-appropriate positive controls (e.g., mouse liver for mouse samples, rat liver for rat samples)

• Predicted reactivity verification: Experimentally confirm predicted cross-reactivity with zebrafish, bovine, and pig RPL23 before proceeding with full experiments

Commercial antibodies typically report tested reactivity (human, mouse, rat) separately from predicted reactivity (zebrafish, bovine, pig), with the latter requiring validation before use in critical experiments .

What emerging applications are being developed for RPL23 antibodies in cancer research?

Several innovative applications are expanding the utility of RPL23 antibodies in cancer research:

• Liquid biopsy development: Exploring RPL23 as a circulating biomarker for early detection and treatment monitoring in cancers with RPL23 dysregulation

• Therapeutic targeting validation: Using RPL23 antibodies to confirm target engagement in drug development pipelines targeting the RPL23-MDM2-p53 axis

• Combination therapy biomarker: Evaluating RPL23 expression as a predictive marker for response to combination therapies including platinum agents and targeted drugs

• Immune checkpoint correlation: Investigating relationships between RPL23 expression and immune checkpoint molecules to identify potential synergistic immunotherapy approaches

• Extracellular vesicle (EV) research: Detecting RPL23 in tumor-derived EVs as potential diagnostic markers or mediators of intercellular communication

Research has demonstrated that targeting RPL23 can restore chemosensitivity in cisplatin-resistant epithelial ovarian cancer, suggesting therapeutic potential that warrants further investigation with appropriate antibody-based validation tools .

How might RPL23 antibodies contribute to understanding ribosomal stress responses?

RPL23 antibodies can facilitate investigation of ribosomal stress response mechanisms:

• Nucleolar stress visualization: Track RPL23 relocalization during ribosomal stress using immunofluorescence with optimized fixation protocols

• Stoichiometric analysis: Quantify changes in free versus ribosome-incorporated RPL23 pools during stress conditions using subcellular fractionation and immunoprecipitation

• Post-translational modification detection: Develop modification-specific antibodies to investigate how PTMs regulate RPL23 function during stress

• MDM2-RPL23 interaction dynamics: Monitor stress-induced changes in RPL23-MDM2 binding using proximity ligation assays and co-immunoprecipitation

• Transcriptional response mapping: Combine RPL23 ChIP with RNA-seq to identify genes regulated by extra-ribosomal RPL23 during stress conditions

Understanding RPL23's role in ribosomal stress responses has implications for developing targeted therapies that modulate these pathways in diseases characterized by ribosomal dysfunction .

What methodological advances are improving RPL23 detection sensitivity and specificity?

Technical innovations are enhancing the performance of RPL23 antibodies in research applications:

• Automated Western blotting systems: Implementation of capillary-based systems (WES) improves quantification reproducibility and reduces sample requirements

• Multiplex detection: Development of multiplexed immunofluorescence panels combining RPL23 with pathway markers enables context-specific expression analysis

• Single-cell applications: Adaptation of RPL23 antibodies for mass cytometry or imaging mass cytometry enables single-cell resolution analysis of expression heterogeneity

• Nanobody development: Creation of RPL23-specific nanobodies with superior tissue penetration for in vivo imaging applications

• CRISPR knock-in validation: Generation of endogenously tagged RPL23 cell lines provides definitive controls for antibody specificity validation

These methodological advances are particularly valuable for studying RPL23 in heterogeneous tumor samples, where cellular context significantly influences its expression and function .