RRAD Antibody

What is RRAD protein and why is it important in research?

RRAD (Ras-related associated with diabetes) is a member of the Ras-like small GTPase family that was initially identified as a gene associated with Type II diabetes due to its overexpression in some diabetic patients . Unlike typical small GTPases, RRAD lacks prenylation motifs at its C-terminus, exhibits low intrinsic GTPase activity, and cannot be stimulated by known GAP molecules . RRAD is particularly important in research because:

• It plays regulatory roles in glucose metabolism and is overexpressed in skeletal muscle of individuals with Type II diabetes

• It exhibits tumor suppressor functions and is frequently down-regulated in multiple cancers including lung, breast, and nasopharyngeal carcinoma due to promoter hypermethylation

• It regulates voltage-dependent L-type calcium channels in cardiomyocytes, affecting cardiac function and rhythm

• It has emerging roles in ferroptosis pathways, particularly in pancreatic cancer

These diverse functions make RRAD antibodies essential tools for investigating metabolic disorders, cancer biology, and cardiac physiology.

What applications are RRAD antibodies validated for?

RRAD antibodies have been validated for multiple research applications across different experimental contexts:

Most commercially available RRAD antibodies show optimal performance in Western blotting, with dilution ranges typically between 1:500-1:3000, and are reactive with human, mouse, and rat samples . For novel applications or sample types, antibody performance should be independently validated.

How should I select between monoclonal and polyclonal RRAD antibodies?

The choice between monoclonal and polyclonal RRAD antibodies depends on your specific experimental requirements:

Monoclonal RRAD antibodies:

• Provide higher specificity for a single epitope (e.g., RRAD antibody [EPR12856] from Abcam)

• Offer better lot-to-lot consistency for longitudinal studies

• Typically yield cleaner Western blot results with fewer non-specific bands

• Ideal for quantitative applications requiring precise epitope recognition

Polyclonal RRAD antibodies:

• Recognize multiple epitopes, potentially increasing sensitivity (e.g., RRAD antibody 27763-1-AP from Proteintech)

• Better for detecting denatured proteins in applications like Western blotting

• May provide stronger signals in techniques like immunohistochemistry

• Often more economical for preliminary studies

For critical experiments requiring absolute specificity, knockout validation offers the highest confidence. For example, Novus Biologicals' NBP2-27500 antibody has been validated against RRAD knockout mouse heart tissue, showing a ~37 kDa band in wild-type samples that is absent in KO samples .

What are the optimal conditions for Western blot detection of RRAD?

For optimal Western blot detection of RRAD protein, follow these evidence-based recommendations:

Sample preparation:

• Extract proteins using RIPA buffer containing protease and phosphatase inhibitors

• For cell lines, collect 2 × 10^7 cells and wash twice with PBS before lysis

• Quantify protein concentration using BCA assay and load approximately 20 μg per lane

Electrophoresis and transfer conditions:

• Use 10% SDS-polyacrylamide gels for optimal resolution

• Transfer to PVDF membranes at standard conditions

Antibody incubation:

• Primary antibody dilutions:

  • Polyclonal antibodies: 1:500-1:3000 (e.g., Proteintech 27763-1-AP)

  • Monoclonal antibodies: 1:1000 (e.g., Abcam EPR12856)

• Secondary antibody: HRP-conjugated anti-rabbit or anti-goat IgG at 1:2000-1:5000 dilution

Expected results:

• Human RRAD: calculated molecular weight of 33 kDa, observed at 29-34 kDa

• Mouse RRAD: observed at approximately 37 kDa in heart tissue

• Positive controls include human fetal heart lysate, mouse heart tissue, and SKOV-3 cells

For verification of specificity, consider using tissues from RRAD knockout animals as negative controls or using antibodies validated through knockout testing .

How can I optimize RRAD immunohistochemistry protocols?

For successful immunohistochemical detection of RRAD in tissue samples:

Tissue preparation:

• Fix tissues in 10% neutral buffered formalin

• Embed in paraffin and section at 4-5 μm thickness

• Perform heat-induced epitope retrieval using citrate buffer (pH 6.0)

Staining protocol:

• Block endogenous peroxidases with 3% hydrogen peroxide

• Use protein blocking solution to reduce background

• Apply primary RRAD antibody (Abcam or Proteintech) at 1:100-1:200 dilution and incubate overnight at 4°C

• Detect with HRP-conjugated secondary antibody and visualize with DAB substrate

• Counterstain with hematoxylin, dehydrate, and mount

Scoring and analysis:

• Score based on staining intensity and percentage of positive cells

• Use a 5-point scale: (1) <5% positive cells; (2) 5-25%; (3) 25-50%; (4) 50-75%; (5) >75%

• Final scores can be classified as low (1-2) or high (3-5)

• Evaluate at least three different fields per slide for reliable quantification

This approach has been successfully used to correlate RRAD expression with clinical parameters in pancreatic cancer studies .

What controls should be included when working with RRAD antibodies?

Rigorous controls are essential for reliable interpretation of RRAD antibody results:

Positive controls:

• Human fetal heart tissue (shows consistent RRAD expression)

• Mouse heart tissue (validated RRAD expression)

• SKOV-3 ovarian cancer cell line (demonstrated RRAD expression)

• HEK293 cells overexpressing RRAD (for antibody validation)

Negative controls:

• RRAD knockout tissues or cells (gold standard)

• Primary antibody omission control

• Isotype control (matched IgG from the same species)

• Tissues known to express minimal RRAD (context-dependent)

Specificity controls:

• Peptide competition assays using the immunizing peptide

• Comparison of staining patterns across antibodies targeting different RRAD epitopes

• Western blot verification alongside immunohistochemistry to confirm specificity

For advanced validation, knockout-validated antibodies like NBP2-27500 provide strong evidence of specificity, as they detect a ~37 kDa band in wild-type mouse heart but not in RRAD knockout heart tissue .

How does RRAD expression differ between normal and disease states?

RRAD expression exhibits significant context-dependent regulation across different disease states:

Diabetes:

• RRAD was initially identified as overexpressed in skeletal muscle of some Type II diabetic patients

• Overexpression reduces insulin-stimulated glucose uptake in muscle and adipocyte cells

• Functions in pathways with AKT and PI3K that regulate glucose metabolism

Cancer:

• RRAD is frequently downregulated in multiple cancer types due to promoter hypermethylation

• Significant downregulation observed in lung cancer, breast cancer, and nasopharyngeal carcinoma

• In pancreatic cancer, RRAD expression is epigenetically silenced by SETD8, contributing to inhibition of ferroptosis

• Low RRAD expression correlates with poor prognosis in pancreatic cancer patients

Cardiac conditions:

• RRAD regulates voltage-dependent L-type Ca²⁺ currents in cardiomyocytes

• Plays a role in cardiac antiarrhythmia through suppression of voltage-gated L-type Ca²⁺ currents

• Inhibits cardiac hypertrophy via the calmodulin-dependent kinase II (CaMKII) pathway

These differential expression patterns highlight the value of RRAD as both a biomarker and therapeutic target, with antibody-based detection providing crucial insights into disease mechanisms.

What molecular mechanisms regulate RRAD expression?

RRAD expression is regulated through multiple molecular mechanisms:

Epigenetic regulation:

• Promoter hypermethylation causes RRAD downregulation in various cancers

• SETD8, a lysine methyltransferase, binds to the RRAD promoter region and epigenetically silences its expression in pancreatic cancer

• Chromatin immunoprecipitation analysis confirms SETD8 interaction with the RRAD promoter region

Transcriptional regulation:

• SETD8 inhibits RRAD transcriptional activity by modifying histone marks at its promoter

• Specific transcription factors involved in basal RRAD expression remain to be fully characterized

Post-transcriptional regulation:

• Evidence suggests microRNA-mediated regulation may contribute to RRAD expression control

• RNA stability mechanisms likely play a role in tissue-specific expression patterns

Metabolic regulation:

• Glucose levels and insulin signaling pathways influence RRAD expression in diabetes context

• Stress conditions can alter RRAD expression levels in a tissue-specific manner

For investigating these regulatory mechanisms, researchers can employ CHIP-qPCR with primers targeting the RRAD promoter region (forward: 5′–AGTTGCTGCTTTTGGCTGATTGGGTT, reverse: 5′–AGTTGCTGCTTTTGGCTGATTGGGTT) .

How do RRAD and SETD8 interact in cancer pathways?

The RRAD-SETD8 regulatory axis represents an important emerging pathway in cancer biology, particularly in pancreatic cancer:

Mechanism of interaction:

• SETD8 is a lysine methyltransferase that directly interacts with the RRAD promoter region

• Through this interaction, SETD8 epigenetically silences RRAD expression

• This silencing occurs through the methylation of histone H4 at lysine 20 (H4K20me1), a known SETD8 target

Functional consequences in cancer:

• RRAD promotes lipid peroxidation in pancreatic cancer cells, potentially inducing ferroptosis

• By inhibiting RRAD expression, SETD8 reduces lipid peroxidation levels and inhibits ferroptosis

• This inhibition of ferroptosis promotes pancreatic cancer cell survival and proliferation

Clinical implications:

• High SETD8 expression and low RRAD expression correlate with poor prognosis in pancreatic cancer patients

• The SETD8-RRAD-ferroptosis axis represents a potential therapeutic target

• Strategies to disrupt SETD8 binding to the RRAD promoter could restore RRAD expression and sensitize cancer cells to ferroptosis

For studying this interaction, researchers should consider combining CHIP assays targeting SETD8 with RRAD expression analysis and functional ferroptosis readouts such as C11-BODIPY staining for lipid peroxidation assessment .

How can I verify RRAD antibody specificity?

Verifying RRAD antibody specificity is crucial for experimental reliability. Consider these approaches:

Genetic validation:

• Use RRAD knockout tissues/cells as negative controls (gold standard approach)

• Compare wild-type vs. knockout samples in Western blot or immunostaining

• Example: Novus NBP2-27500 antibody shows a ~37 kDa band in wild-type mouse heart but not in RRAD knockout tissue

Overexpression validation:

• Test antibody against cells overexpressing tagged RRAD

• Compare with cells expressing related GTPases to confirm specificity

• Example: NBP2-27500 antibody detects HA-tagged mouse Rrad but not related mouse GTPases in transfected HEK293 cells

Peptide competition:

• Pre-incubate antibody with immunizing peptide before application

• Signal should be significantly reduced if antibody is specific

• Particularly useful for antibodies raised against synthetic peptides

Antibody Registry verification:

• Check if the antibody has a Research Resource Identifier (RRID)

• Antibodies in the Registry have persistent records and may have validation data

• Example: Proteintech's 27763-1-AP has RRID: AB_3085993

Multi-antibody concordance:

• Compare results from multiple antibodies targeting different RRAD epitopes

• Consistent detection patterns across antibodies support specificity

These approaches should be applied in the context of your specific experimental system and application.

What are common pitfalls in RRAD antibody experiments and how can they be addressed?

Researchers working with RRAD antibodies should be aware of these common challenges and their solutions:

Non-specific background in Western blots:

• Problem: Some RRAD antibodies show non-specific background bands

• Solution: Optimize blocking conditions (5% BSA often works better than milk for GTPases)

• Solution: Increase washing duration and stringency with 0.1% Tween-20 in TBS

• Solution: Use knockout-validated antibodies like NBP2-27500 that show clear specific bands

Variability in molecular weight detection:

• Problem: RRAD appears at varying molecular weights (29-37 kDa) across different studies

• Solution: Recognize that the calculated molecular weight is 33 kDa, but observed weight varies by species and experimental conditions

• Solution: Include positive controls with known RRAD expression (e.g., heart tissue) alongside experimental samples

Low signal in immunohistochemistry:

• Problem: Weak RRAD staining in tissue sections

• Solution: Optimize antigen retrieval (citrate buffer at pH 6.0 works well)

• Solution: Extend primary antibody incubation to overnight at 4°C

• Solution: Use signal amplification systems compatible with your detection method

Inconsistent results in cell lines:

• Problem: Variable RRAD detection across experiments

• Solution: Consider the cell context - RRAD expression is highly regulated by cancer status and metabolic conditions

• Solution: Document passage number and growth conditions carefully

• Solution: Validate expression at mRNA level via qPCR alongside protein detection

Immunoprecipitation inefficiency:

• Problem: Poor RRAD pull-down in IP experiments

• Solution: Optimize lysis conditions to maintain native protein conformation

• Solution: Consider pre-clearing lysates to reduce non-specific binding

• Solution: Use magnetic beads instead of agarose for more efficient capture

How should RRAD antibodies be stored and handled to maintain performance?

Proper storage and handling of RRAD antibodies is essential for maintaining their performance characteristics:

Storage recommendations:

• Store at -20°C according to manufacturer recommendations

• Antibodies are typically stable for one year after shipment when stored properly

• For some formulations, aliquoting is unnecessary for -20°C storage (e.g., Proteintech 27763-1-AP)

• Small volume formulations (20 μl) often contain 0.1% BSA as a stabilizer

Buffer composition:

• Most RRAD antibodies are provided in PBS with 0.02% sodium azide and 50% glycerol at pH 7.3

• This formulation enhances stability during freeze-thaw cycles

• Sodium azide prevents microbial contamination but may inhibit HRP in some applications

Handling best practices:

• Allow antibody to equilibrate to room temperature before opening

• Briefly centrifuge vials before opening to collect solution at the bottom

• Use sterile technique when handling to prevent contamination

• Avoid repeated freeze-thaw cycles by preparing working aliquots if needed

Working dilution preparation:

• Dilute antibodies in fresh buffer immediately before use

• For Western blotting, prepare dilutions in 5% BSA in TBST for optimal results

• Follow recommended dilution ranges: 1:500-1:3000 for Western blot applications

• Store diluted antibody at 4°C for short-term use (1-7 days) or discard after use

Following these guidelines will help maintain antibody affinity and specificity throughout your experimental timeline.

How are RRAD antibodies being used in cancer research?

RRAD antibodies are becoming increasingly important in cancer research, with several emerging applications:

Biomarker development:

• RRAD downregulation occurs across multiple cancer types including lung, breast, and nasopharyngeal carcinoma

• Immunohistochemical detection of RRAD levels can potentially stratify patients for prognosis

• In pancreatic cancer, low RRAD expression correlates with poor patient outcomes

Epigenetic regulation studies:

• RRAD antibodies are used alongside ChIP assays to investigate epigenetic silencing mechanisms

• The SETD8-RRAD regulatory axis reveals how epigenetic modifiers control tumor suppressor genes

• This research has identified promoter hypermethylation as a key mechanism of RRAD silencing in cancer

Ferroptosis pathway investigation:

• RRAD promotes lipid peroxidation in pancreatic cancer cells, potentially inducing ferroptosis

• Antibodies enable correlation of RRAD expression with lipid peroxidation levels (measured by C11-BODIPY staining)

• This connection between RRAD and ferroptosis represents a novel angle for therapeutic development

Therapeutic target validation:

• As the SETD8-RRAD-ferroptosis axis emerges as a potential therapeutic target, antibodies provide crucial validation tools

• Monitoring RRAD restoration after experimental therapies targeting its epigenetic silencing

• Correlating RRAD expression with response to ferroptosis-inducing compounds

These applications highlight how RRAD antibodies contribute to both basic mechanistic understanding and translational research in oncology.

What role does RRAD play in cardiac function and how can antibodies help study this?

RRAD exhibits important functions in cardiac physiology that can be investigated using antibody-based approaches:

Calcium channel regulation:

• RRAD regulates voltage-dependent L-type Ca²⁺ currents in cardiomyocytes

• It influences beta-adrenergic augmentation of Ca²⁺ influx, affecting heart rate and contractile force

• RRAD strongly suppresses voltage-gated L-type Ca²⁺ currents, potentially providing antiarrhythmic effects

Trafficking mechanisms:

• RRAD regulates voltage-dependent L-type calcium channel subunit alpha-1C trafficking to the cell membrane

• Antibody-based imaging can track this trafficking in cardiomyocytes

Cardiac hypertrophy inhibition:

• RRAD inhibits cardiac hypertrophy through the calmodulin-dependent kinase II (CaMKII) pathway

• It specifically inhibits phosphorylation and activation of CAMK2D

• Immunohistochemistry with RRAD antibodies can assess expression changes during hypertrophy development

Research applications:

• Western blotting with RRAD antibodies in heart tissue reveals expression levels in different cardiac conditions

• Immunoprecipitation can identify novel RRAD binding partners in cardiac tissue

• Cardiac-specific knockout models combined with antibody validation provide insights into RRAD's role in heart function

These studies are facilitated by antibodies validated specifically in cardiac tissue, such as those tested in mouse and rat heart samples , providing important tools for cardiovascular research.

How can RRAD antibodies contribute to diabetes and metabolic research?

Given RRAD's original identification in diabetes research, antibodies against this protein offer valuable tools for metabolic investigations:

Expression analysis in diabetic tissues:

• RRAD was initially discovered as overexpressed in skeletal muscle of Type II diabetic patients

• Antibodies enable comparative expression studies between diabetic and non-diabetic tissues

• Immunohistochemistry can map RRAD distribution across tissues relevant to glucose homeostasis

Insulin signaling pathway interactions:

• RRAD overexpression reduces insulin-stimulated glucose uptake in muscle and adipocyte cells

• Antibody-based co-immunoprecipitation can identify RRAD's binding partners in insulin signaling

• Phospho-specific antibodies could potentially reveal how RRAD activation state changes with insulin stimulation

Therapeutic target assessment:

• As RRAD influences glucose uptake, it represents a potential therapeutic target for metabolic disorders

• Antibodies provide tools to monitor RRAD modulation in response to experimental therapies

• Expression changes can be correlated with improvements in glucose tolerance or insulin sensitivity

Translational applications:

• Immunohistochemical detection of RRAD in patient biopsies may help stratify diabetic subtypes

• Correlation of RRAD levels with clinical parameters could identify prognostic biomarkers

• Monitoring RRAD expression changes in response to standard diabetes treatments

These applications highlight how RRAD antibodies can bridge basic science and clinical research in metabolic disorders, where RRAD's role was first recognized.