RPS22A Antibody

Shipped with Ice Packs
In Stock

Description

Biological Role of RPS22A

RPS22A is encoded by the RPS22A gene in yeast and is critical for ribosome assembly and translational fidelity. Key characteristics include:

  • Molecular Function: Integral component of the 40S ribosomal subunit, facilitating mRNA decoding during protein synthesis .

  • Regulation: Its transcription is tightly controlled by promoters shared with adjacent ribosomal protein genes (e.g., RPL24A), involving transcription factors like Rap1 .

  • Paralog Compensation: Similar to other ribosomal proteins, RPS22A may have paralogs (e.g., RPS22B) that compensate under stress or genetic depletion .

Applications of RPS22A Antibody in Research

The antibody is utilized in diverse experimental workflows:

2.1. Protein Detection and Quantification

  • Western Blot (WB): Identifies RPS22A in lysates, distinguishing its size (~15–23 kDa depending on post-translational modifications) .

  • Immunoprecipitation (IP): Isolates ribosome-associated complexes for proteomic or interactome studies .

2.2. Subcellular Localization

  • Immunofluorescence (IF): Maps RPS22A to nucleolar regions or cytoplasmic ribosomes, as demonstrated in analogous studies on RpL22 .

2.3. Functional Studies

  • Splicing Regulation: Antibodies help validate RPS22A’s autoregulatory roles, such as modulating pre-mRNA splicing of paralogs under stress .

  • Ribosome Profiling: Coupled with techniques like RiboTag (HA-tagged ribosomes), it enables cell-type-specific translatome analysis .

Table 1: RPS22A Protein Attributes

PropertyDetail
Molecular Weight~15 kDa (native); up to 23 kDa with tags (e.g., HA)
Isoelectric Point (pI)Computationally derived; varies by post-translational modifications
AbundanceHigh (ribosomal proteins constitute ~80% of cellular RNA-bound proteins)
DomainsRibosomal protein S22/S23 family domain

Table 2: Primer Sequences for RPS22A mRNA Analysis

Primers from studies on ribosomal protein genes :

Primer NameSequence (5’→3’)Target
JW2258CTCTCAAGTTATTGTCTTGGTGTCRPL24A/RPS22A promoter
JW61LCATCTCTGCGTATATTGATTAAGFP/RPL30
JW2407ATGTGGTGCACAGATGTAACGRPL24A/RPS22A promoter

Research Findings Enabled by RPS22A Antibody

  • Transcriptional Coordination: RPS22A’s promoter overlaps with RPL24A, and both are co-regulated by Rap1, as shown by chromatin immunoprecipitation (ChIP) and Northern blotting .

  • Stress Response: Under DNA damage (e.g., methyl methanesulfonate exposure), RPS22A levels are modulated via splicing autoregulation, a mechanism conserved in paralogs like RPL22B .

  • Ribosome Assembly: Antibody-based IP confirmed RPS22A’s interaction with other ribosomal proteins (e.g., RPL7) in polysome profiles .

Product Specs

Buffer
**Preservative:** 0.03% Proclin 300
**Constituents:** 50% Glycerol, 0.01M PBS, pH 7.4
Form
Liquid
Lead Time
Made-to-order (14-16 weeks)
Synonyms
RPS22A antibody; RPS24 antibody; RPS24A antibody; YJL190C antibody; J0355 antibody; 40S ribosomal protein S22-A antibody; RP50 antibody; S24 antibody; Small ribosomal subunit protein uS8-A antibody; YP58 antibody; YS22 antibody
Target Names
RPS22A
Uniprot No.

Target Background

Function
RPS22A is a component of the ribosome, a large ribonucleoprotein complex essential for protein synthesis within the cell. The small ribosomal subunit (SSU) binds messenger RNAs (mRNAs) and interprets the encoded message by selecting appropriate aminoacyl-transfer RNA (tRNA) molecules. The large subunit (LSU) houses the ribosomal catalytic site, known as the peptidyl transferase center (PTC), which facilitates the formation of peptide bonds, effectively linking amino acids delivered by tRNAs to create a polypeptide chain. Newly synthesized polypeptides exit the ribosome through a tunnel within the LSU, interacting with protein factors that orchestrate enzymatic processing, targeting, and the integration of nascent chains into cellular membranes at the exit of the ribosomal tunnel.
Database Links

KEGG: sce:YJL190C

STRING: 4932.YJL190C

Protein Families
Universal ribosomal protein uS8 family
Subcellular Location
Cytoplasm.

Q&A

What is Ribosomal Protein S2 and why is it important in research?

Ribosomal Protein S2 (RPS2) is a crucial component of the 40S ribosomal subunit involved in protein translation. RPS2 plays an essential role in ribosome assembly and function across diverse species, making it a valuable target for studying fundamental cellular processes. The protein contains several conserved domains and is highly conserved across species including humans, mice, rats, and even yeast species like Saccharomyces cerevisiae, with predicted reactivity ranging from 79% in yeast to 100% in several mammalian species . Its evolutionary conservation makes it an excellent model protein for comparative studies of translation mechanisms across different organisms and experimental systems.

What types of RPS2 antibodies are available for research applications?

Several types of RPS2 antibodies are available for research, varying in their target epitopes, host species, and applications:

  • Polyclonal antibodies targeting N-terminal regions (e.g., AA 2-61)

  • Polyclonal antibodies targeting C-terminal regions

  • Monoclonal antibodies targeting specific regions (e.g., AA 198-293)

  • Unconjugated antibodies for standard applications

  • Host options including rabbit polyclonal and mouse monoclonal variants

For comprehensive studies, researchers should select antibodies targeting either N-terminal or C-terminal regions based on protein accessibility in their experimental context. Multiple antibody options with different clonality characteristics allow for validation through complementary approaches.

What applications are RPS2 antibodies validated for?

RPS2 antibodies have been validated for multiple research applications, including:

  • Western Blotting (WB) - Primary validation method for most available antibodies

  • Enzyme-Linked Immunosorbent Assay (ELISA)

  • Immunofluorescence (IF)

  • Immunohistochemistry (IHC)

  • Immunocytochemistry (ICC)

  • Flow cytometry applications (FACS)

Western blotting remains the most commonly validated application, with specific antibodies showing high sensitivity and specificity across multiple species. For more specialized applications like immunofluorescence or flow cytometry, researchers should verify that the specific antibody clone has been validated for their intended application.

How should experiments be designed to study RPS2 in yeast models?

When designing experiments to study RPS2 in yeast models like Saccharomyces cerevisiae, researchers should consider:

  • Strain selection: Different yeast strains (e.g., W303α, SS328) can significantly influence expression levels of recombinant proteins and antibody reactivity .

  • Growth conditions: Culture temperature (typically 30°C), media composition, and growth phase significantly impact RPS2 expression and detection.

  • Genetic modifications: Consider how genetic modifications might impact ribosomal protein expression. For example, deletions affecting endoplasmic reticulum morphology (Δopi1, Δrtn1, Δrtn2, Δyop1) can influence protein expression levels by 1.3-1.5 fold compared to wild-type strains .

  • Controls: Include appropriate wild-type controls alongside genetically modified strains to accurately assess the impact of your experimental variables on RPS2 expression or function.

  • Detection method: Western blotting with appropriate loading controls is essential for quantitative analysis of RPS2 levels in different strains or conditions .

What are the critical factors for optimizing Western blotting with RPS2 antibodies?

For optimal Western blotting results with RPS2 antibodies, researchers should:

  • Sample preparation: Properly prepare cell extracts as described in established protocols. For yeast samples, methods like those described by Piirainen and Frey (2020) are recommended .

  • SDS-PAGE conditions: Use 12.5% SDS-PAGE gels for optimal resolution of RPS2 protein bands.

  • Transfer conditions: Optimize transfer time and voltage for ribosomal proteins, which may require different conditions than larger proteins.

  • Antibody dilution: For primary antibodies, a 1:1,000 dilution is typically recommended, while secondary antibodies perform best at 1:50,000 dilution for enhanced signal-to-noise ratio .

  • Validation controls: Include positive controls with known RPS2 expression and negative controls to confirm antibody specificity.

  • Signal detection: Use appropriate imaging systems and software (e.g., Image Lab 5.1) for quantitative analysis of immunoblot results .

How can RPS2 antibodies be utilized to study protein expression stress responses?

RPS2 antibodies can be valuable tools for investigating protein expression stress responses, particularly in relation to endoplasmic reticulum (ER) stress and the unfolded protein response (UPR):

  • Monitor expression in relation to UPR markers: RPS2 expression can be analyzed alongside UPR markers like Kar2p (BiP) to understand ribosomal protein regulation during ER stress .

  • Genetic modification studies: Compare RPS2 levels in wild-type strains versus strains with modifications affecting ER morphology (e.g., Δopi1, Δrtn1, Δrtn2, Δyop1) to understand how ER structure influences ribosomal protein synthesis .

  • Correlation with recombinant protein expression: Measure RPS2 levels alongside recombinant protein expression to identify potential bottlenecks in the translation machinery during high-demand states.

  • Time-course experiments: Track RPS2 levels at different timepoints during stress induction to capture dynamic changes in the translation machinery.

This approach allows researchers to understand how ribosomal components respond to cellular stress and potentially identify new targets for optimizing recombinant protein production.

What considerations are important when comparing RPS2 expression across different species?

When comparing RPS2 expression or function across species, researchers should consider:

  • Sequence homology: RPS2 has varying degrees of conservation across species (e.g., 100% in humans, mice, and rats; 93% in zebrafish; 79% in yeast) . These differences may affect antibody binding and cross-reactivity.

  • Antibody validation: Confirm that your antibody has been validated for each species of interest. The predicted reactivity data indicates: Cow: 100%, Dog: 100%, Goat: 100%, Guinea Pig: 92%, Horse: 100%, Human: 100%, Mouse: 100%, Rabbit: 85%, Rat: 100%, Yeast: 79%, Zebrafish: 93% .

  • Expression level normalization: Use appropriate loading controls specific to each species to normalize expression data.

  • Species-specific modifications: Consider post-translational modifications that may be species-specific and affect antibody recognition.

  • Background signal: Different species may exhibit different levels of non-specific binding, requiring optimization of blocking and washing protocols.

How does ER morphology modification influence recombinant protein expression in yeast?

Modification of endoplasmic reticulum (ER) morphology has significant impacts on recombinant protein expression in yeast that can be studied using ribosomal protein antibodies:

  • Deletion of ER-shaping proteins: Deletion of genes encoding reticulon proteins (Rtn1p, Rtn2p) and Yop1p in various combinations influences ER morphology and capacity.

  • Expression improvement: Strains with Opi1- background combined with deletions of ER-shaping proteins (Δopi1Δrtn2Δyop1, Δopi1Δrtn1Δrtn2, Δopi1Δrtn1Δrtn2Δyop1) show more than 2-fold higher specific antibody titers compared to control strains .

  • Protein-specific effects: The impact of ER modifications varies depending on the target protein. For example:

    • Nanobody constructs showed approximately 2-fold higher titers compared to full-length antibody expression across tested strains

    • SEAP activity was enhanced by 1.5-fold in the Δopi1Δrtn1Δrtn2Δyop1 strain compared to wild-type controls

    • Endogenous AP activity showed no statistically significant difference between modified strains and controls

  • Growth impact: Modified strains often display altered growth characteristics, including longer lag phases and lower final cell densities (approximately 73% of control strain density) .

This information suggests that optimizing ER morphology through genetic modifications can significantly enhance recombinant protein production in a protein-specific manner.

What are the most common technical challenges when using RPS2 antibodies?

Researchers frequently encounter these technical challenges when working with RPS2 antibodies:

  • Cross-reactivity: Due to the high conservation of ribosomal proteins, antibodies may cross-react with related proteins, requiring stringent validation.

  • Background signal: Ribosomal proteins are highly abundant, which can lead to high background signal requiring optimization of blocking conditions and antibody dilutions.

  • Protein degradation: Rapid sample processing is essential as ribosomal proteins can be susceptible to degradation during extended extraction procedures.

  • Quantification challenges: When quantifying RPS2 levels, appropriate normalization and loading controls are critical for accurate interpretation.

  • Strain-specific variations: Different yeast strains may require optimization of protocols, as demonstrated by the varied expression levels observed between W303α and SS328 backgrounds .

What verification methods should be used when working with RPS2 antibodies in genome-edited models?

When working with genome-edited models, several verification methods should be employed to confirm proper integration and expression:

  • PCR verification: Conduct PCR to verify proper integration of cassettes near the 5' end of the ORF. For example, when using a DHFR cassette, expected band sizes typically range between 700-900 nucleotides, which can be verified using appropriate DNA ladders (e.g., GeneRuler 100 bp) .

  • Western blotting: Confirm expression of fusion proteins (e.g., Dhfr-linker-interactor proteins) to verify successful insertion of the cassette .

  • Growth phenotype analysis: Compare growth rates of modified strains to wild-type controls, as genome modifications often impact growth characteristics .

  • Functional assays: Perform functional assays specific to your protein of interest to verify that the modified protein maintains its expected activity.

  • Sequencing: When necessary, sequencing the integration junctions can provide definitive confirmation of proper cassette integration.

What transformation protocols are recommended for yeast studies involving ribosomal proteins?

For yeast transformation in studies involving ribosomal proteins, the following protocol is recommended:

  • Preparation: Mix 50 μL of yeast culture with 1-2 μL of plasmid in transformation mix.

  • Incubation: Carefully mix and incubate cultures at 30°C for 30 minutes, followed by a 20-minute incubation in a 42°C water bath.

  • Recovery phase: For drug selection plates, add 500 μL of appropriate media (without drugs) to the tubes and allow overnight growth. This crucial step enables sufficient accumulation of drug-resistance proteins before selection.

  • Pelleting and plating: After overnight incubation, pellet the yeast and resuspend in 100 μL of residual liquid before spreading the entire content onto selection plates .

  • Verification: After colony formation, verify transformants using the methods described in the previous question, particularly PCR verification and Western blotting.

This protocol optimizes transformation efficiency while ensuring proper expression of introduced genetic constructs, which is particularly important when studying ribosomal proteins that may affect the translation machinery itself.

How might RPS2 antibodies contribute to advancements in recombinant protein production?

RPS2 antibodies can play a significant role in advancing recombinant protein production through:

  • Optimization of expression systems: By monitoring RPS2 levels in different strain backgrounds, researchers can identify genetic modifications that enhance translational capacity for recombinant protein production.

  • Stress response characterization: Analyzing how RPS2 expression changes during recombinant protein overexpression can help identify bottlenecks in the translation machinery.

  • Strain engineering validation: When developing new yeast strains with modified ER morphology (e.g., Δopi1Δrtn1Δrtn2Δyop1), RPS2 antibodies can help validate that ribosomal function remains intact despite structural modifications to the ER.

  • Quality control metrics: RPS2 levels can serve as a potential quality control marker for assessing translational capacity in production strains.

  • Comparative analysis: Comparing RPS2 expression across different expression systems (e.g., W303α vs. SS328 backgrounds) can guide selection of optimal production platforms for specific recombinant proteins .

These applications highlight how fundamental research on ribosomal proteins can translate into practical improvements in biotechnology applications.

What emerging technologies might enhance the utility of RPS2 antibodies in research?

Several emerging technologies show promise for enhancing the utility of RPS2 antibodies in research:

  • Protein complementation assays (PCA): Systems like the dihydrofolate reductase enzyme-based PCA screen can provide novel insights into mRNA 3'-UTR-mediated processes and how they affect ribosomal protein function .

  • Advanced imaging techniques: Super-resolution microscopy combined with immunofluorescence using RPS2 antibodies can provide spatial information about ribosome distribution in modified ER morphologies.

  • Single-cell proteomics: Emerging single-cell proteomic approaches could utilize RPS2 antibodies to understand cell-to-cell variation in translation capacity within heterogeneous cultures.

  • CRISPR-based genome editing: More precise integration of tags or modifications to RPS2 using CRISPR-Cas9 technology can facilitate more sophisticated functional studies.

  • Multiplexed antibody-based assays: Simultaneous detection of multiple ribosomal proteins and ER stress markers can provide a more comprehensive view of the translation machinery's response to experimental conditions.

Quick Inquiry

Personal Email Detected
Please use an institutional or corporate email address for inquiries. Personal email accounts ( such as Gmail, Yahoo, and Outlook) are not accepted. *
© Copyright 2025 TheBiotek. All Rights Reserved.