RUNX1T1 Antibody

What is RUNX1T1 and what is its biological function?

RUNX1T1 (Runt-related transcription factor 1, translocated to, 1) functions as a transcriptional corepressor that facilitates transcriptional repression through association with DNA-binding transcription factors and recruitment of other corepressors and histone-modifying enzymes . It has been shown to repress the expression of MMP7 in a ZBTB33-dependent manner and can repress transactivation mediated by TCF12 . Evidence suggests it acts as a negative regulator of adipogenesis. The protein is notably expressed in the testis, nasopharynx, fallopian tube, and bronchus . RUNX1T1 belongs to the CBFA2T protein family and plays significant roles in various cellular processes, including transcriptional regulation.

What are the common alternative names and identifiers for RUNX1T1?

RUNX1T1 is known by several synonyms in the scientific literature, which is important to recognize when conducting comprehensive literature searches. These alternative names include: AML1T1, CBFA2T1, CDR, ETO, MTG8, ZMYND2, Protein CBFA2T1, Cyclin-D-related protein, Eight twenty one protein, Protein ETO, Protein MTG8, and Zinc finger MYND domain-containing protein 2 . The GenBank Accession Number is BC005850, Gene ID (NCBI) is 862, and the UNIPROT ID is Q06455 . Understanding these alternative identifiers is crucial for comprehensive database searches and literature reviews.

What are the molecular characteristics of RUNX1T1 protein?

RUNX1T1 has a calculated molecular weight of 68 kDa but is typically observed at 70-75 kDa in experimental conditions . This discrepancy between calculated and observed molecular weights is important to note when interpreting Western blot results. The protein exists in multiple isoforms with molecular weights of 68, 67, 64, 48, and 44 kDa . The canonical protein in humans has a reported length of 604 amino acid residues and a mass of 67.6 kDa . Its subcellular localization is primarily in the nucleus, consistent with its role in transcriptional regulation. Up to 6 different isoforms have been reported for this protein, which may have tissue-specific expression patterns and functions.

Which species show cross-reactivity with RUNX1T1 antibodies?

Many commercially available RUNX1T1 antibodies demonstrate cross-reactivity with samples from multiple species. For instance, antibody 67086-1-Ig shows validated reactivity with human, mouse, rat, and pig samples . RUNX1T1 gene orthologs have been reported in mouse, rat, bovine, frog, zebrafish, chimpanzee, and chicken species . When selecting an antibody for cross-species applications, researchers should verify the specific cross-reactivity profile of their chosen antibody, as this may vary between products and manufacturers. The high degree of conservation across species makes RUNX1T1 antibodies valuable tools for comparative studies.

What are the main applications of RUNX1T1 antibodies in research?

RUNX1T1 antibodies are utilized across multiple experimental applications in molecular and cellular biology research. Common applications include:

It is recommended that researchers titrate antibodies in each testing system to obtain optimal results, as optimal dilutions can be sample-dependent .

What are the optimal storage and handling conditions for RUNX1T1 antibodies?

For maximum stability and performance of RUNX1T1 antibodies, proper storage and handling are essential. Most RUNX1T1 antibodies should be stored at -20°C, where they typically remain stable for one year after shipment . The standard storage buffer often consists of PBS with 0.02% sodium azide and 50% glycerol at pH 7.3 . Aliquoting is generally unnecessary for -20°C storage, which simplifies laboratory management. Some preparations may contain 0.1% BSA in small (20μl) sizes .

When working with these antibodies, it's advisable to minimize freeze-thaw cycles, keep them on ice during experiments, and return them to storage promptly after use. Always refer to the manufacturer's specific recommendations, as optimal conditions may vary between products.

How can researchers validate RUNX1T1 antibody specificity?

Validating antibody specificity is a critical step in ensuring experimental reliability. For RUNX1T1 antibodies, consider these validation approaches:

• Knockout Controls: Generate RUNX1T1 CRISPR/Cas9 knockout cell lines using guide RNAs (e.g., AAGAGTTCGCACCCTCGTTC) on a pLentiCRISPRv2 vector . Absence of signal in knockout samples strongly supports antibody specificity.

• Overexpression Controls: Create RUNX1T1 overexpressing cell lines using lentiviral transduction of FLAG-tagged RUNX1T1 . Enhanced signal in these cells provides evidence for specificity.

• Multiple Antibody Comparison: Use antibodies from different sources or those targeting different epitopes of RUNX1T1 to confirm consistent detection patterns.

• Molecular Weight Verification: Confirm that detected bands align with expected molecular weights (70-75 kDa observed, though multiple isoforms exist) .

• Immunoprecipitation Analysis: Perform IP followed by mass spectrometry to confirm the identity of the precipitated protein.

These validation steps are especially important given the multiple isoforms and molecular weights associated with RUNX1T1 protein.

What is the role of RUNX1T1 in acute myeloid leukemia?

RUNX1T1 has significant implications in acute myeloid leukemia (AML), particularly in the M2 subtype, where the t(8;21)(q22;q22) translocation represents one of the most frequent karyotypic abnormalities . This translocation produces a chimeric gene composed of the 5'-region of the RUNX1 gene fused to the 3'-region of the RUNX1T1 gene, resulting in the AML1-MTG8/ETO fusion protein .

This fusion protein is critically involved in leukemogenesis and contributes to hematopoietic stem/progenitor cell self-renewal . Various transcripts of this fusion gene have been reported in the literature. RUNX1T1 antibodies are valuable tools for studying this translocation and its products, which can provide insights into AML pathogenesis and potential therapeutic targets. Research using these antibodies has contributed to understanding how the fusion protein disrupts normal hematopoietic differentiation and promotes leukemogenesis.

How does RUNX1T1 affect cell cycle regulation through CDKN1A expression?

Validation experiments in multiple lung cancer cell lines have demonstrated that RUNX1T1 overexpression consistently decreases CDKN1A (p21) expression . This finding suggests RUNX1T1 may function as an epigenetic modifier influencing cell cycle regulation, as p21 is a critical cyclin-dependent kinase inhibitor that regulates cell cycle progression.

Additionally, RUNX1T1 overexpression has been shown to increase E2F activity , which further supports its role in cell cycle control. These regulatory mechanisms may partly explain RUNX1T1's involvement in cancer development and progression. For researchers investigating cell cycle dysregulation in cancer, monitoring RUNX1T1 and CDKN1A expression levels using specific antibodies can provide valuable insights into these regulatory pathways.

What methodological considerations are important for RUNX1T1 in situ hybridization?

For researchers interested in detecting RUNX1T1 mRNA expression in tissue samples, in situ hybridization provides valuable spatial information. Key methodological considerations include:

• Probe Selection: Custom RUNX1T1 probes that detect all RUNX1T1 mRNA variants should be designed for comprehensive detection .

• Detection System: Chromogenic RNAscope 2.5 HD Duplex Detection Kit has been successfully used for RUNX1T1 detection in tissue microarray (TMA) slides .

• Control Probes: Consider co-hybridization with standard probes (such as MYC) to generate distinct signals for comparison and validation .

• Specimen Types: This approach has been validated on both c-SCLC specimens and mixed lung cancer specimens, including 'pure' SCLC .

• Quantification Methods: Develop robust image analysis protocols to quantify RUNX1T1 expression levels across different samples.

In situ hybridization complements antibody-based detection methods by providing mRNA expression data with preserved spatial context, which is particularly valuable for heterogeneous tissues.

How can RUNX1T1 function be experimentally modulated?

Researchers have several options for modulating RUNX1T1 function in experimental settings:

• Overexpression Systems: RUNX1T1 can be overexpressed by transducing cells with lentiviral particles for FLAG-tagged RUNX1T1. Typically, cells are transduced at 5 MOI with polybrene, changed to fresh medium after 24 hours, and selected under G418 treatment (1–3 mg/ml) for at least 2 weeks .

• CRISPR/Cas9 Knockout: RUNX1T1 function can be eliminated using CRISPR/Cas9 technology. Guide RNAs (e.g., AAGAGTTCGCACCCTCGTTC) delivered via a pLentiCRISPRv2 vector through lentiviral transduction have been effective. Cells are typically selected under puromycin at 0.5μg/ml for about two weeks to generate stable knockout lines .

• Related Pathway Modulation: RUNX1T1's function can be studied in context with related pathways, such as by generating RB1 knockdown cell lines using lentiviral plasmid pLKO.1-RB1-shRNA19 .

These experimental approaches enable researchers to investigate RUNX1T1's functional roles in various cellular contexts and disease models.

What are common challenges when working with RUNX1T1 antibodies in Western blotting?

Western blotting with RUNX1T1 antibodies presents several challenges that researchers should anticipate:

• Multiple Isoform Detection: RUNX1T1 exists in multiple isoforms (68, 67, 64, 48, and 44 kDa) , which can result in multiple bands that may be difficult to interpret. Researchers should be familiar with the expected banding pattern for their specific cell type or tissue.

• Observed vs. Calculated Weight Discrepancy: While the calculated molecular weight is 68 kDa, the observed molecular weight is typically 70-75 kDa . This discrepancy should be considered when interpreting results.

• Optimal Dilution Determination: The recommended dilution range for Western blotting is broad (1:1000-1:6000) , suggesting that optimization is necessary for each experimental system.

• Antibody Cross-Reactivity: When working with non-human samples, ensure the antibody has been validated for cross-reactivity with your species of interest. Many RUNX1T1 antibodies work with human, mouse, rat, and pig samples , but specificity should be verified.

• Detection of Fusion Proteins: In leukemia research, the detection of RUNX1-RUNX1T1 fusion proteins requires careful antibody selection to ensure recognition of the relevant epitope.

Optimization through titration experiments and inclusion of appropriate positive and negative controls is essential for reliable Western blot results with RUNX1T1 antibodies.

How can researchers distinguish between RUNX1T1 isoforms in experimental settings?

Distinguishing between the multiple RUNX1T1 isoforms (68, 67, 64, 48, and 44 kDa) requires careful methodological considerations:

• High-Resolution Gel Systems: Use gradient gels (e.g., 4-12% or 4-20%) with extended running times to achieve better separation of closely sized isoforms.

• Isoform-Specific Antibodies: When available, use antibodies raised against epitopes unique to specific isoforms. If studying the fusion protein in leukemia, ensure antibodies recognize the appropriate regions.

• Complementary RNA Analysis: Combine protein detection with RT-PCR using isoform-specific primers to correlate protein bands with specific mRNA variants.

• Mass Spectrometry: For definitive identification, consider immunoprecipitation followed by mass spectrometry analysis to characterize the exact isoforms present in your samples.

• Recombinant Protein Standards: Include recombinant RUNX1T1 isoforms as size standards when possible to provide precise molecular weight references.

Understanding the expression patterns of different RUNX1T1 isoforms can provide valuable insights into tissue-specific functions and disease-related alterations.

How might the study of RUNX1T1 impact our understanding of transcriptional regulation in disease states?

RUNX1T1's role as a transcriptional corepressor positions it as a key player in gene regulation networks relevant to multiple disease states. Future research directions may include:

• Epigenetic Modifier Characterization: Further exploration of RUNX1T1 as a potential epigenetic modifier in small cell lung cancer and other malignancies .

• Therapeutic Target Development: Investigation of RUNX1T1 and RUNX1-RUNX1T1 fusion proteins as therapeutic targets, particularly in acute myeloid leukemia where the t(8;21) translocation is common .

• Regulatory Network Mapping: Comprehensive mapping of RUNX1T1 interactions with other transcription factors and corepressors across different cellular contexts.

• Isoform-Specific Functions: Determination of the specific roles of different RUNX1T1 isoforms in normal development and disease progression.

• Single-Cell Analysis: Application of single-cell technologies to understand RUNX1T1 expression heterogeneity within tissues and its implications for disease progression.

As research techniques continue to advance, our understanding of RUNX1T1's multifaceted roles in transcriptional regulation and disease pathogenesis will likely expand, potentially revealing new diagnostic markers and therapeutic opportunities.

What novel technical approaches might enhance RUNX1T1 detection and functional analysis?

Emerging technologies offer exciting possibilities for advancing RUNX1T1 research:

• Proximity Ligation Assays: Further development of Proximity Ligation Assay (PLA) techniques for studying RUNX1T1 protein-protein interactions in situ.

• CRISPR Screening: Application of genome-wide CRISPR screens to identify synthetic lethal interactions with RUNX1T1 alterations, particularly in leukemia models.

• Single-Molecule Imaging: Development of tools for real-time imaging of RUNX1T1 dynamics within living cells to understand its temporal regulation.

• Proteomics Integration: Combination of RUNX1T1 antibody-based techniques with advanced proteomics to comprehensively characterize RUNX1T1 interaction networks and post-translational modifications.

• Spatial Transcriptomics: Integration of in situ hybridization techniques with spatial transcriptomics to understand RUNX1T1 expression in the context of the tissue microenvironment.

These technical advances will provide researchers with powerful tools to deepen our understanding of RUNX1T1 biology and its implications in health and disease.