S100A14 Human

What is S100A14 and what are its fundamental characteristics?

S100A14, also known as Breast Cancer Membrane Protein 84, is a member of the S100 calcium-binding protein family containing one EF-hand domain. First identified in 2002 through analysis of human lung cancer cell lines, it functions as a homodimer that can interact with the receptor for advanced glycation end products (RAGE) . S100A14 can modulate p53/TP53 protein levels and plays roles in cell survival and apoptosis regulation at different concentrations via RAGE. Additionally, it participates in cell migration regulation by modulating MMP2 levels, a matrix protease under transcriptional control of p53/TP53 .

Research methodology for characterizing S100A14:

• Recombinant protein expression in E. coli systems

• Protein purification techniques including affinity chromatography

• Structural analysis using crystallography or NMR spectroscopy

• Calcium-binding assays to assess functional domains

How is S100A14 expressed across normal human tissues?

S100A14 expression is highly heterogeneous among normal human tissues, suggesting tissue- and context-specific regulation and function. Tissues with epithelial-parenchymal phenotypes (colon, rectum, small intestine, stomach, thymus, thyroid, kidney, and lungs) express significantly higher levels of S100A14 mRNA. In contrast, tissues with mesenchymal-stromal phenotypes (brain, white blood cells, muscles, and spleen) express negligible amounts of S100A14 mRNA .

Data from the Human Protein Atlas, GTEx, and FANTOM5 databases have consistently demonstrated higher expression of S100A14 in various parts of the oral-digestive tract and skin. Notably, anatomical sites with higher S100A14 expression typically include simple or stratified epithelium as a major component of their structures .

Methodological approaches for tissue expression profiling:

• Northern blot analysis for comparative tissue expression

• Immunohistochemistry with optimized antibodies

• RNA-seq and microarray analysis for quantitative assessment

• Single-cell RNA sequencing for cellular heterogeneity analysis

How does S100A14 expression vary across different cancer types?

S100A14 shows remarkable cancer type-specific expression patterns:

This differential expression pattern suggests that S100A14 may have opposing functions depending on the tissue context .

What key molecular interactions and signaling pathways involve S100A14?

S100A14 interacts with multiple signaling molecules and pathways:

• p53/TP53 pathway: S100A14 modulates p53 protein levels, influencing cell survival and apoptosis pathways .

• Matrix metalloproteases: Regulates MMP1, MMP2, MMP9, and MMP13, affecting extracellular matrix remodeling and cell invasion .

• RAGE signaling: Interacts with receptor for advanced glycation end products, triggering downstream signaling cascades .

• E-cadherin regulation: S100A14 overexpression increases E-cadherin expression in colon cancer cells, affecting cell adhesion properties .

• STAT3-PD-L1 axis: Inhibits PD-L1 expression by directly interacting with STAT3 and inducing its proteasomal degradation .

• Calcium signaling: Blocks store-operated Ca²⁺ influx by suppressing Orai1 and STIM1 expression, affecting FAK activation and focal adhesion assembly .

• Additional interactions: NF-kB, JunB, actin, and HER2 .

These diverse interactions explain the complex and context-dependent functions of S100A14 in different tissues.

What are the tissue-specific functional roles of S100A14 in cancer biology?

S100A14 exhibits remarkable tissue-specific functions:

In gastrointestinal tract cancers:

• Functions as a tumor suppressor

• Induces cellular differentiation in gastric cancer by upregulating E-cadherin and PGII expression

• Reduces cell motility and invasion capabilities

• Decreases colony formation in soft agar, indicating reduced anchorage-independent growth

In hepatocellular carcinoma:

• Acts as a tumor promoter

• Promotes cell proliferation and invasion in vitro

• Enhances tumor growth and metastasis in vivo

• Knockdown of S100A14 results in smaller subcutaneous tumor xenografts and reduced lung metastases in severe combined immunodeficient mice

In lung adenocarcinoma:

• Promotes malignant behavior

• Downregulation correlates with reduced migration (scratch assay) and decreased invasion (Matrigel invasion assay)

• High expression associates with lymph node metastasis, intratumoral vascular invasion, and pleural invasion

This dichotomy suggests that experimental approaches must be carefully designed with consideration of tissue-specific contexts when studying S100A14 functions.

How does S100A14 mechanistically regulate cell migration and invasion?

The mechanisms by which S100A14 regulates cell migration and invasion are complex and cancer type-dependent:

In colon cancer:

• Overexpression of S100A14 in SW480 cells significantly reduces the number of cells penetrating an 8μm pore filter after 24h of incubation

• In scratch wound assays, S100A14 transfectants show a four-fold decrease in wound closure after 24h

• S100A14 increases E-cadherin expression, promoting stronger cell-cell adhesion and reducing motility

In gastric cancer:

• S100A14 blocks store-operated Ca²⁺ influx by suppressing Orai1 and STIM1 expression

• This calcium signaling modulation leads to FAK activation and focal adhesion assembly

• Results in downregulation of matrix metalloproteases

• Collectively inhibits cell migration and invasion

For studying these mechanisms, researchers should employ:

• Live-cell migration tracking with time-lapse microscopy

• Focal adhesion dynamics assessment using fluorescent tagging

• Calcium flux measurements using fluorescent indicators

• Proteomic analysis of the adhesion complex components

What experimental approaches are effective for modulating S100A14 expression in laboratory studies?

Several validated approaches for manipulating S100A14 expression include:

For overexpression:

• Stable transfection with expression vectors (e.g., pCMV6-Myc-DDK-S100A14)

• Selection of transfected cells using G418 (0.5-2 μg/ml) for 3-4 weeks

• Verification by Western blot analysis

For knockdown/silencing:

• shRNA transduction targeting S100A14 (validated sequence: GAGACCCTCATCAAGAACTTT)

• Selection of stably transduced cells using puromycin (1-2 μg/ml) for approximately three weeks

• siRNA-mediated transient knockdown for short-term studies

• Verification of knockdown efficiency by qRT-PCR and Western blot

For functional studies:

• Recombinant S100A14 protein treatment (commercially available from sources like ProSci Inc.)

• CRISPR-Cas9 gene editing for complete knockout

• Inducible expression systems for temporal control

• Domain-specific mutants to dissect functional regions

Validation methods should include multiple independent clones and rescue experiments to confirm specificity of observed phenotypes.

How can researchers effectively resolve contradictory findings about S100A14 functions in different cancer models?

The apparently contradictory functions of S100A14 across cancer types present a significant research challenge. Strategies to address these contradictions include:

• Comprehensive interactome analysis: Perform mass spectrometry-based interactome studies in different tissue contexts to identify tissue-specific binding partners that may explain divergent functions.

• Multi-omics integration: Combine transcriptomic, proteomic, and phosphoproteomic data to map downstream signaling pathways activated by S100A14 in different cellular contexts.

• Tissue-specific conditional models: Develop conditional knockout or overexpression mouse models specific to epithelial or mesenchymal tissues to study context-dependent functions in vivo.

• Signaling pathway verification: Test the activation status of key pathways (RAGE, p53, E-cadherin, STAT3) in different experimental models to identify tissue-specific signaling mechanisms.

• Single-cell analysis: Employ single-cell RNA-seq and proteomics to account for cellular heterogeneity within tissues that may explain mixed results in bulk analyses.

• Domain-specific functional analysis: Create truncation or point mutation variants to determine which domains are responsible for tissue-specific functions.

These approaches can help elucidate the molecular basis for S100A14's seemingly opposite functions in different cancer types.

What is the clinical significance of S100A14 as a prognostic biomarker and therapeutic target?

S100A14 shows significant potential as both a prognostic biomarker and therapeutic target:

As a prognostic biomarker:

This dichotomy suggests that S100A14 evaluation must be cancer type-specific for accurate prognostication.

As a therapeutic target:

• In colorectal cancer: S100A14-based therapy has been suggested as an effective strategy to prevent tumor progression

• S100A14 may serve as a predictive biomarker for response to:

  • Anti-PD-L1 immunotherapy

  • Chemotherapy when used in combination treatments

• Targeting S100A14-mediated calcium signaling pathways offers potential for novel therapeutic approaches

Methodological considerations for clinical translation:

• Standardization of immunohistochemical staining protocols

• Development of companion diagnostics for patient stratification

• Validation in large multicenter cohorts

• Integration with existing clinical prognostic factors

What is the relationship between S100A14 and PD-L1 in cancer stemness and therapy resistance?

Recent research has revealed a critical relationship between S100A14 and PD-L1 with implications for cancer stemness and treatment resistance:

• S100A14 expression is downregulated in PD-L1high colorectal cancer cells, which display cancer stem-like cell (CSC) phenotypes and immune-suppressive capacities

• S100A14 inhibits PD-L1 expression through a specific molecular mechanism:

  • Direct interaction with STAT3

  • Induction of STAT3 proteasomal degradation

  • Reduction of PD-L1 transcription due to decreased STAT3 activity

Experimental evidence shows:

• PD-L1high subpopulations exhibit greater resistance to 5-fluorouracil/oxaliplatin-based chemotherapy

• Chemoresistant CRC sublines established through prolonged exposure to chemotherapy show altered S100A14-PD-L1 regulation

• Targeting the S100A14-STAT3-PD-L1 axis could potentially overcome chemoresistance

This relationship positions S100A14 as a potential predictive biomarker for immunotherapy response and a target for overcoming therapy resistance, particularly in colorectal cancer.

How does S100A14 interact with calcium signaling pathways in cancer progression?

As a calcium-binding protein of the S100 family, S100A14's interactions with calcium signaling are integral to its functions:

• S100A14 contains an EF-hand domain that enables calcium binding and subsequent conformational changes

• In gastric cancer, S100A14 has been shown to block store-operated Ca²⁺ influx through:

  • Suppression of Orai1 and STIM1 expression

  • Alteration of calcium-dependent signaling cascades

  • Subsequent activation of FAK signaling

  • Promotion of focal adhesion assembly

  • Downregulation of matrix metalloproteases

These calcium-dependent mechanisms ultimately inhibit cell migration and invasion in gastric cancer, contributing to S100A14's tumor-suppressive function in this context.

Research methodology for investigating calcium interactions:

• Live-cell calcium imaging using fluorescent indicators

• Calcium binding assays with purified recombinant protein

• Mutagenesis of calcium-binding domains

• Calcium channel activity measurements in various cellular contexts

What standardized methods exist for accurate assessment of S100A14 expression in research and clinical applications?

Several validated methods are available for assessing S100A14 expression:

For mRNA expression:

• Quantitative RT-PCR using validated primer sets

• RNAscope in situ hybridization for spatial expression analysis

• NanoString technology for precise quantification

• RNA-seq for comprehensive transcriptomic profiling

• Analysis of public databases (Human Protein Atlas, GTEx, FANTOM5) for reference data

For protein expression:

• Western blotting using validated antibodies

• Immunohistochemistry (IHC) with standardized protocols and scoring systems

• Immunofluorescence for subcellular localization

• ELISA for quantitative assessment in tissue lysates or body fluids

• Mass spectrometry for absolute quantification and post-translational modification analysis

For clinical applications:

• Tissue microarrays for high-throughput screening

• Digital pathology with automated scoring algorithms

• Multiplex IHC for simultaneous assessment of S100A14 and interacting partners

When establishing these methods, researchers should consider:

• Inclusion of appropriate positive and negative controls

• Validation across multiple antibody clones

• Correlation between mRNA and protein expression

• Reproducibility across different laboratories and platforms