S100A7A Antibody

What is S100A7A and how does it differ from S100A7?

S100A7A (also known as S100 calcium-binding protein A15, S100 calcium-binding protein A7-like 1, koebnerisin, and protein S100-A7A) is a member of the S-100 protein family with a length of 101 amino acid residues and a molecular weight of approximately 11.3 kDa . Despite sharing high sequence homology with S100A7 (psoriasin), S100A7A is a distinct protein with potentially different functions. Both proteins are suspected to be involved in epidermal differentiation and inflammation processes, making them potentially important in the pathogenesis of psoriasis and other inflammatory skin conditions . The key differences include their expression patterns in tissues and potentially distinct roles in cellular processes.

What are the typical expression patterns of S100A7A in normal and disease states?

S100A7A shows expression in multiple tissue types with distinct patterns compared to S100A7. In normal tissues, S100A7A is expressed in epithelial cells, myoepithelial cells surrounding breast alveoli, and endothelial cells, while S100A7 is more restricted to certain epithelial tissues . In disease states, S100A7A shows significant heterogeneity in expression across squamous cell carcinomas (SCCs), with notable expression in:

This heterogeneous expression pattern suggests tissue-specific functions in disease progression .

How should researchers distinguish between S100A7 and S100A7A antibodies?

Distinguishing between S100A7 and S100A7A antibodies requires careful consideration due to their high sequence homology. When selecting antibodies:

• Verify antibody specificity through manufacturer validation data showing testing against both proteins

• Look for antibodies raised against unique epitopes, particularly the N-terminal region which tends to differ between these proteins

• Consider monoclonal antibodies over polyclonal when specificity is critical

• Examine cross-reactivity data in Western blots with recombinant proteins for both S100A7 and S100A7A

• Review literature where the specificity of the antibody has been rigorously validated

Research has shown that some commercial antibodies previously used for studying S100A7 expression actually recognize both S100A7 and S100A15/S100A7A proteins, potentially confounding earlier studies .

What validation methods ensure S100A7A antibody specificity?

For rigorous validation of S100A7A antibody specificity:

• Perform Western blotting with recombinant S100A7A and S100A7 proteins to assess cross-reactivity

• Include related family members (S100A8, S100A10) as negative controls

• Conduct preabsorption studies with the corresponding proteins to confirm specificity

• Use tissues with known differential expression patterns of S100A7 and S100A7A as positive and negative controls

• Employ immunoblotting of native proteins from human keratinocyte lysates

• Consider verification through genetic approaches (knockdown/knockout models) or peptide competition assays

Studies have specifically demonstrated that monospecific antisera developed against the N-terminal sequence of S100A15/S100A7A can successfully distinguish between these highly homologous proteins .

What are the optimal applications for S100A7A antibody detection?

S100A7A antibodies have been validated for multiple applications with varying degrees of optimization:

Western blotting represents the most commonly validated application across commercial antibodies, while immunofluorescence and immunohistochemistry provide critical spatial information about S100A7A distribution in tissues and cells .

What protocol optimizations are required for Western blot detection of S100A7A?

For optimal Western blot detection of S100A7A:

• Sample preparation: Use appropriate lysis buffers containing protease inhibitors to prevent degradation

• Gel selection: Employ 15-20% SDS-PAGE gels suitable for small proteins (S100A7A is approximately 11 kDa)

• Transfer conditions: Optimize transfer time and voltage for small proteins; PVDF membranes may offer better retention

• Blocking: Use 5% non-fat milk or BSA as recommended by the specific antibody manufacturer

• Antibody dilution: Typical working dilutions range from 1:500-1:2000 for primary antibodies; optimize empirically

• Detection systems: Enhanced chemiluminescence systems provide good sensitivity for S100A7A detection

• Controls: Include recombinant S100A7A protein as a positive control (appears at ~11 kDa)

Note that S100A7A may exist in modified or cross-linked forms in tissues, potentially resulting in bands at unexpected molecular weights .

How can researchers interpret heterogeneous S100A7A staining patterns?

S100A7A exhibits significant heterogeneity in expression, appearing as patchy or scattered distribution in positive tissues . When interpreting these patterns:

• Examine multiple tissue regions and fields to account for this heterogeneity

• Quantify the percentage of positive cells rather than relying on binary positive/negative classification

• Correlate protein expression with mRNA levels using specific qPCR primers for S100A7A

• Consider co-staining with differentiation markers (keratins 4, 13, TG-1, involucrin) as S100A7A expression has been linked to squamous differentiation

• Assess the relationship between staining intensity and clinicopathological parameters (e.g., tumor grade, patient outcomes)

• Compare expression patterns across different anatomical sites of the same disease

Research has shown that S100A7A-positive cells may represent specific subpopulations within tissues that can be induced under certain conditions both in vitro and in vivo .

What are the common sources of false results in S100A7A detection?

Understanding potential sources of false results is critical for accurate S100A7A detection:

False positives:

• Cross-reactivity with S100A7 due to high sequence homology

• Non-specific binding to other calcium-binding proteins

• Excessive antigen retrieval causing non-specific epitope exposure

False negatives:

• Post-translational modifications masking the epitope recognized by the antibody

• Protein-protein interactions blocking antibody access

• Heterogeneous expression requiring examination of multiple fields

• Sample processing causing protein degradation

Studies have shown that S100A7A protein may exist in modified/cross-linked forms in tissues, which can prevent detection as the expected 11 kDa monomer in some contexts .

How can researchers design experiments to differentiate S100A7 and S100A7A functions?

To distinguish the potentially distinct functions of these highly homologous proteins:

• Employ specific genetic manipulation through CRISPR/Cas9 or RNAi targeting each gene individually

• Utilize cell models with differential expression of each protein (e.g., HCC94 cells express S100A7A, while FaDu and A-431 cells show minimal expression under normal conditions)

• Perform dual immunofluorescence with validated specific antibodies to examine co-localization or distinct distribution patterns

• Analyze the impact of overexpression or knockdown on:

  • Cell proliferation (S100A7A overexpression has been shown to increase proliferation)

  • Squamous differentiation markers (S100A7A silencing increases expression of keratin-4, keratin-13, TG-1, and involucrin)

• Compare effects on downstream signaling pathways

• Examine extracellular functions, as both proteins may be secreted and have distinct roles

Studies have demonstrated that S100A7A acts as a dual regulator, promoting proliferation while suppressing squamous differentiation in squamous cell carcinoma .

What methodologies help investigate S100A7A induction mechanisms?

To study the induction mechanisms of S100A7A expression:

• Design in vitro models to recapitulate in vivo induction conditions

• Establish real-time monitoring systems using:

  • qPCR for mRNA expression with specific primers (forward: ACGTCACTCCTGTCTCTCTTTGCT, reverse: TGATGAATCAACCCATTTCCTGGG)

  • Luciferase reporter assays driven by the S100A7A promoter

• Investigate regulatory elements controlling expression through:

  • Chromatin immunoprecipitation to identify transcription factor binding

  • Promoter deletion/mutation studies

• Examine the relationship between S100A7A and squamous differentiation markers (keratin-4, keratin-13, TG-1, and involucrin), which show coordinated expression

• Compare expression induction in different cell types (HCC94, FaDu, and A-431 cells have been shown to induce S100A7A expression under certain conditions)

Understanding these mechanisms may provide insights into the role of S100A7A in disease progression and potential therapeutic approaches.

How does S100A7A expression correlate with clinical parameters in cancer?

Understanding the clinical significance of S100A7A expression requires careful analysis:

• Perform tissue microarray analysis across large cohorts of patients with various cancer types

• Correlate expression levels with:

  • Tumor grade and differentiation status

  • Tumor stage and invasiveness

  • Patient survival and response to therapy

• Compare expression patterns in primary tumors versus metastatic lesions

• Assess the relationship between S100A7A expression and ER/PR status in breast cancer (high expression of both S100A7 and S100A15/S100A7A transcripts has been linked to ER negativity)

• Evaluate potential as a diagnostic or prognostic biomarker

Research indicates that the staining intensity of S100A7 is inversely associated with the degree of differentiation in squamous cell carcinomas, suggesting a complex relationship between S100A7A/S100A7 expression and tumor behavior .

What methodological approaches help distinguish S100A7A from S100A7 in archived tissue samples?

For accurate discrimination in archived samples:

• Employ double immunofluorescence staining with validated antibodies specific to each protein

• Use spectral imaging to separate signals when working with potentially cross-reactive antibodies

• Perform RNA in situ hybridization with gene-specific probes to detect distinct mRNA expression

• Consider laser capture microdissection followed by:

  • RT-PCR with specific primers for each transcript

  • Mass spectrometry to identify unique peptides distinguishing the proteins

• Use multiparameter analysis that includes known differential expression contexts (e.g., myoepithelial cells in breast tissue express S100A15/S100A7A but not S100A7)

These approaches are essential for accurate retrospective analysis of clinical samples and correlation with patient outcomes.