SBT3.8 Antibody

Shipped with Ice Packs
In Stock

Description

Biological Role of SBT3.8

SBT3.8 is a plant-specific subtilase involved in processing peptide precursors critical for stress acclimation. Key functions include:

  • Post-translational modification: Cleaves precursor peptides like phytosulfokine (PSK) and root meristem growth factor (RGF) to produce bioactive signaling molecules .

  • Stress response regulation: Facilitates osmotic and drought stress tolerance by enhancing lateral root development and mitigating growth inhibition under stress .

  • Substrate specificity: Requires an aspartate residue at the P1’ position of its substrates for cleavage, as demonstrated in PSK1 precursor processing assays .

SBTAntibody in Research

The antibody enables detection and quantification of SBT3.8 protein expression, aiding studies on its regulatory roles. Key applications include:

  • Immunoblot analysis: Confirming SBT3.8 overexpression in transgenic Arabidopsis lines (e.g., SBT3.8ox) .

  • Expression profiling: Monitoring SBT3.8 levels under stress conditions, such as osmotic stress induced by mannitol .

  • Functional studies: Linking SBT3.8 activity to stress-related pathways, including ABA biosynthesis and PSK signaling .

Table 1: Key Features of SBT3.8 Antibody

ApplicationTarget SpeciesReactivity Confirmed InCitation
ImmunoblotArabidopsis thalianaTransgenic overexpression lines
Stress responseArabidopsis thalianaRoot and shoot tissue under osmotic stress

Stress Acclimation Mechanisms

  • Osmotic stress: sbt3.8 mutants exhibit reduced lateral root formation and shoot/root biomass under mannitol stress compared to wild-type plants .

  • Overexpression effects: SBT3.8ox plants show enhanced stress tolerance, with 20–30% greater fresh weight and lateral root counts under osmotic stress .

Enzymatic Activity

  • Substrate processing: SBT3.8 cleaves the PSK1 precursor at pH 5.5, generating the mature PSK peptide (5-aa sulfated tyrosine motif) .

  • Mutagenesis studies: Replacing the critical aspartate residue (Asp→Ala) in proPSK1 abolishes cleavage, confirming enzymatic specificity .

Table 2: Primer Sequences for SBT3.8-Related Studies

TargetForward Primer (5’→3’)Reverse Primer (5’→3’)Source
SBT3.8Not explicitly providedNot explicitly provided
PSK1CTCTATCCAGCTCGACGGTCTTCACACCCACCTCCTCAC

Implications for Plant Biology

  • Stress signaling: SBT3.8-mediated peptide processing enhances ABA biosynthesis under drought, improving stress resilience .

  • Agricultural potential: Engineering SBT3.8 overexpression could optimize crop tolerance to water scarcity .

Product Specs

Buffer
Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M Phosphate Buffered Saline (PBS), pH 7.4
Form
Liquid
Lead Time
Made-to-order (14-16 weeks)
Synonyms
SBT3.8 antibody; At4g10540 antibody; F3H7.2 antibody; F7L13.120Subtilisin-like protease SBT3.8 antibody; EC 3.4.21.- antibody; Subtilase subfamily 3 member 8 antibody; AtSBT3.8 antibody
Target Names
SBT3.8
Uniprot No.

Target Background

Database Links

KEGG: ath:AT4G10540

STRING: 3702.AT4G10540.1

UniGene: At.54261

Protein Families
Peptidase S8 family
Subcellular Location
Secreted.

Q&A

What is SBT3.8 and why is it significant in plant research?

SBT3.8 is a subtilisin-like serine protease that functions as an Asp-specific protease (phytaspase) in plants. It plays a crucial role in osmotic stress responses by processing phytosulfokine (PSK) peptide precursors. Research has demonstrated that SBT3.8 expression is upregulated during osmotic stress conditions, and the enzyme specifically cleaves at the C-terminus of the PSK pentapeptide in the PSK1 precursor . This processing is dependent on an aspartic acid residue adjacent to the cleavage site. Plants lacking functional SBT3.8 (sbt3.8 mutants) show increased sensitivity to osmotic stress, while SBT3.8 overexpression enhances stress tolerance .

What detection methods can be employed with SBT3.8 antibodies?

For SBT3.8 detection, researchers can employ multiple techniques:

  • Western blot analysis: Useful for quantifying SBT3.8 protein expression changes during osmotic stress conditions. This approach was successfully used to confirm SBT3.8 overexpression in transgenic Arabidopsis plants using immunoblot analysis with anti-SBT3.8 antibodies .

  • Immunohistochemistry: For visualizing SBT3.8 localization in plant tissues, particularly in root tissues where SBT3.8 functions in lateral root development.

  • Co-immunoprecipitation: Essential for investigating protein-protein interactions between SBT3.8 and its substrates, such as PSK precursors.

  • ELISA: For quantitative measurement of SBT3.8 levels across different tissues or treatment conditions.

How can I optimize antibody dilutions for SBT3.8 detection in Western blots?

When optimizing SBT3.8 antibody dilutions for Western blot experiments:

  • Start with a titration experiment using 1:500, 1:1000, and 1:2000 dilutions of primary antibody

  • Use recombinant SBT3.8 protein as a positive control (similar to the C-terminally hexa-His-tagged SBT3.8 described in the research)

  • Include sbt3.8 mutant tissue extracts as a negative control to confirm antibody specificity

  • For enhanced detection, consider using chemiluminescent substrates with varying exposure times

  • When working with SBT3.8-GFP fusion proteins, validate using both anti-SBT3.8 and anti-GFP antibodies to confirm expression, as was done in the SBT3.8ox transgenic plants

How can I distinguish between cleaved and uncleaved forms of SBT3.8 substrates using antibody-based techniques?

To differentiate between processed and unprocessed forms of SBT3.8 substrates like proPSK1:

Methodology:

  • Generate antibodies against specific epitopes that span the cleavage site in the PSK precursor

  • Design an immunodetection strategy using antibodies that recognize either:

    • The intact precursor form (spanning the cleavage junction)

    • The processed form (recognizing neo-epitopes created after cleavage)

Experimental approach:

  • Compare protein patterns from wild-type and sbt3.8 mutant extracts

  • Include recombinant proPSK1 and SBT3.8-processed proPSK1 as controls

  • For in vitro validation, use the digestion approach described in the research where recombinant proPSK1 was incubated with purified SBT3.8 and cleavage products were analyzed by SDS-PAGE

  • For more precise analysis, combine with mass spectrometry to identify specific cleavage products, similar to the approach that identified C-terminal processing of proPSK1 by SBT3.8

What experimental strategies can verify SBT3.8 substrate specificity in vivo?

To investigate SBT3.8 substrate specificity in living plant tissues:

Recommended approach:

  • Generate transgenic lines expressing:

    • Wild-type potential substrates

    • Site-directed mutants where the critical Asp residue is replaced by Ala (similar to the proPSK1 D→A mutation that prevented cleavage by SBT3.8)

  • Use antibodies to track processing in:

    • Wild-type plants

    • sbt3.8 mutants

    • SBT3.8 overexpression lines (SBT3.8ox)

  • Complementary techniques:

    • Exudate incubation assays comparing wild-type and sbt3.8 mutant seedling exudates, which confirmed SBT3.8's role in processing both proPSK1 and proRGF1 in the research

    • Analysis of phenotypic rescue through application of mature peptides to mutant tissues, such as the application of PSK peptide to sbt3.8 mutants which improved lateral root development

How can I design immunoprecipitation experiments to capture SBT3.8-substrate complexes?

For successful immunoprecipitation of SBT3.8-substrate complexes:

  • Antibody selection:

    • Use anti-SBT3.8 antibodies for direct precipitation

    • Consider epitope-tagged versions (like the C-terminal sfGFP fusion used in SBT3.8ox plants) with corresponding tag antibodies

  • Crosslinking strategy:

    • Implement reversible crosslinking to capture transient enzyme-substrate interactions

    • Use low-temperature conditions to slow enzymatic processing

  • Controls and validation:

    • Include catalytically inactive SBT3.8 mutants to stabilize the enzyme-substrate complex

    • Compare complexes from plants under normal and osmotic stress conditions, as osmotic stress upregulates both SBT3.8 and PSK precursor genes

    • Verify results with mass spectrometry to identify captured substrates

What controls are essential when using SBT3.8 antibodies for plant stress studies?

When investigating SBT3.8's role in stress responses, include these critical controls:

Essential controls:

  • Genetic controls:

    • sbt3.8 loss-of-function mutant tissues (negative control)

    • SBT3.8 overexpression lines (positive control)

    • Other SBT mutants (sbt1.4, sbt3.7) for specificity comparison

  • Experimental controls:

    • Time-course sampling to track SBT3.8 expression dynamics during stress response

    • Compare multiple stress conditions (osmotic, salt, temperature) to assess specificity

    • Include known stress marker genes (At3g14067, At3g46280, At2g42540) as positive controls for stress induction

  • Antibody controls:

    • Pre-immune serum control

    • Peptide competition assay to verify epitope specificity

    • Cross-reactivity assessment with related SBT family proteins

How can I optimize immunolocalization of SBT3.8 in plant tissues?

For effective immunolocalization of SBT3.8 in plant tissues:

Sample preparation protocol:

  • Carefully fix tissues using paraformaldehyde while preserving antigenicity

  • Use gentle cell wall digestion to improve antibody penetration

  • Block with 3-5% BSA containing 0.1% Triton X-100 to reduce background

Detection optimization:

  • For root tissues, where SBT3.8 functions in lateral root development, use thin sections (50-100 µm) to improve antibody access

  • Compare expression patterns in osmotic stress-treated vs. control seedlings

  • Consider dual immunostaining with markers for cell wall, Golgi, or secretory pathway components to determine precise subcellular localization

  • Include fluorescently tagged SBT3.8-GFP plants as positive controls, similar to the SBT3.8-sfGFP fusion described in the research

What troubleshooting strategies are recommended for inconsistent SBT3.8 antibody signals?

If experiencing variable SBT3.8 antibody signals:

Problem-solving approach:

  • Variable expression levels:

    • SBT3.8 is upregulated by osmotic stress , so standardize growing conditions

    • Monitor expression timing - collect tissues at consistent developmental stages

    • Quantify transcript levels by qPCR to correlate with protein detection

  • Technical considerations:

    • Optimize extraction buffers to effectively solubilize membrane-associated SBT3.8

    • Include protease inhibitors to prevent degradation during extraction

    • Consider epitope masking issues if working with SBT3.8 complexes

  • Alternative approaches:

    • Use SBT3.8-tag fusion proteins for detection with commercial tag antibodies

    • Combine with activity-based protein profiling to correlate protein levels with enzymatic activity

    • Consider mass spectrometry-based quantification for absolute quantification

How can antibodies help elucidate SBT3.8's role in drought stress signaling pathways?

Antibodies can reveal SBT3.8's function in drought stress signaling through:

Research approaches:

  • Signaling pathway analysis:

    • Immunoprecipitate SBT3.8 complexes from control and stressed tissues to identify interaction partners

    • Use phospho-specific antibodies to determine if SBT3.8 is regulated by stress-induced phosphorylation

  • Spatiotemporal dynamics:

    • Track SBT3.8 protein levels across different tissues during progressive drought stress

    • Correlate with PSK peptide production using custom antibodies against the mature PSK peptide

    • Compare with expression patterns of PSK receptor proteins

  • Translational implications:

    • Compare SBT3.8 expression, localization, and activity across drought-sensitive and drought-resistant plant varieties

    • Investigate if SBT3.8 overexpression consistently improves osmotic stress tolerance across different plant species or varieties

What experimental design is optimal for analyzing SBT3.8-dependent PSK processing in different plant tissues?

To comprehensively analyze SBT3.8-dependent PSK processing:

Experimental design table:

Tissue TypeGenotypes to CompareTreatmentsDetection MethodsExpected Outcomes
RootWild-type, sbt3.8, SBT3.8oxControl, MannitolWestern blot, ImmunohistochemistryIncreased PSK processing in stressed wild-type and SBT3.8ox
ShootWild-type, sbt3.8, SBT3.8oxControl, MannitolWestern blot, ImmunohistochemistryTissue-specific processing patterns
SeedlingsWild-type, sbt3.8, SBT3.8oxTime course of stressWestern blot, qPCRTemporal correlation between SBT3.8 expression and PSK processing
Cell culturesWild-type, sbt3.8Control, MannitolExudate analysis, Mass spectrometryDirect assessment of secreted PSK peptides

Additional considerations:

  • Include site-directed PSK precursor mutants (D→A) to confirm Asp-dependence of processing in each tissue context

  • Supplement biochemical analyses with phenotypic assessments (lateral root development, fresh weight measurements) to correlate molecular changes with physiological outcomes

  • Compare with other known SBT3.8 substrates like proRGF1 to assess substrate preferences in different tissues

How should researchers interpret contradictory data between transcript levels and protein abundance for SBT3.8?

When facing discrepancies between SBT3.8 transcript and protein levels:

Analytical framework:

  • Post-transcriptional regulation:

    • Investigate microRNA-mediated regulation of SBT3.8 mRNA

    • Assess mRNA stability under different stress conditions

  • Post-translational mechanisms:

    • Examine protein turnover rates using cycloheximide chase experiments

    • Investigate if SBT3.8 undergoes self-processing or is targeted by other proteases

    • Consider stress-induced changes in protein stability or compartmentalization

  • Technical considerations:

    • Verify antibody is detecting all forms of SBT3.8 (precursor and mature)

    • Use multiple antibodies targeting different epitopes

    • Implement absolute quantification methods for both transcript (digital PCR) and protein (selected reaction monitoring mass spectrometry)

  • Biological interpretation:

    • Remember that SBT3.8 functions in a proteolytic cascade and its activity may be more relevant than absolute abundance

    • Correlate with functional outputs like PSK peptide levels or phenotypic traits (lateral root development, osmotic stress tolerance)

How might new antibody-based technologies advance our understanding of SBT3.8 function?

Emerging antibody technologies could transform SBT3.8 research:

  • Single-cell proteomics:

    • Cell-type specific analysis of SBT3.8 expression and activity using highly sensitive antibody-based detection systems

    • Correlation with single-cell transcriptomics to identify regulatory mechanisms

  • In vivo biosensors:

    • Development of FRET-based sensors using anti-SBT3.8 antibody fragments to monitor conformational changes during activation

    • Creation of activity reporters based on PSK processing to visualize SBT3.8 activity in living cells

  • Proteome-wide substrate screening:

    • Antibody-based enrichment of processed peptides following SBT3.8 activity

    • Comparison between wild-type and sbt3.8 mutant proteomes to identify novel substrates beyond PSK and RGF1

    • Integration with structural biology approaches to develop predictive models for substrate recognition

Quick Inquiry

Personal Email Detected
Please use an institutional or corporate email address for inquiries. Personal email accounts ( such as Gmail, Yahoo, and Outlook) are not accepted. *
© Copyright 2025 TheBiotek. All Rights Reserved.