SBT3.8 is a plant-specific subtilase involved in processing peptide precursors critical for stress acclimation. Key functions include:
Post-translational modification: Cleaves precursor peptides like phytosulfokine (PSK) and root meristem growth factor (RGF) to produce bioactive signaling molecules .
Stress response regulation: Facilitates osmotic and drought stress tolerance by enhancing lateral root development and mitigating growth inhibition under stress .
Substrate specificity: Requires an aspartate residue at the P1’ position of its substrates for cleavage, as demonstrated in PSK1 precursor processing assays .
The antibody enables detection and quantification of SBT3.8 protein expression, aiding studies on its regulatory roles. Key applications include:
Immunoblot analysis: Confirming SBT3.8 overexpression in transgenic Arabidopsis lines (e.g., SBT3.8ox) .
Expression profiling: Monitoring SBT3.8 levels under stress conditions, such as osmotic stress induced by mannitol .
Functional studies: Linking SBT3.8 activity to stress-related pathways, including ABA biosynthesis and PSK signaling .
| Application | Target Species | Reactivity Confirmed In | Citation |
|---|---|---|---|
| Immunoblot | Arabidopsis thaliana | Transgenic overexpression lines | |
| Stress response | Arabidopsis thaliana | Root and shoot tissue under osmotic stress |
Osmotic stress: sbt3.8 mutants exhibit reduced lateral root formation and shoot/root biomass under mannitol stress compared to wild-type plants .
Overexpression effects: SBT3.8ox plants show enhanced stress tolerance, with 20–30% greater fresh weight and lateral root counts under osmotic stress .
Substrate processing: SBT3.8 cleaves the PSK1 precursor at pH 5.5, generating the mature PSK peptide (5-aa sulfated tyrosine motif) .
Mutagenesis studies: Replacing the critical aspartate residue (Asp→Ala) in proPSK1 abolishes cleavage, confirming enzymatic specificity .
| Target | Forward Primer (5’→3’) | Reverse Primer (5’→3’) | Source |
|---|---|---|---|
| SBT3.8 | Not explicitly provided | Not explicitly provided | |
| PSK1 | CTCTATCCAGCTCGACGGT | CTTCACACCCACCTCCTCAC |
SBT3.8 is a subtilisin-like serine protease that functions as an Asp-specific protease (phytaspase) in plants. It plays a crucial role in osmotic stress responses by processing phytosulfokine (PSK) peptide precursors. Research has demonstrated that SBT3.8 expression is upregulated during osmotic stress conditions, and the enzyme specifically cleaves at the C-terminus of the PSK pentapeptide in the PSK1 precursor . This processing is dependent on an aspartic acid residue adjacent to the cleavage site. Plants lacking functional SBT3.8 (sbt3.8 mutants) show increased sensitivity to osmotic stress, while SBT3.8 overexpression enhances stress tolerance .
For SBT3.8 detection, researchers can employ multiple techniques:
Western blot analysis: Useful for quantifying SBT3.8 protein expression changes during osmotic stress conditions. This approach was successfully used to confirm SBT3.8 overexpression in transgenic Arabidopsis plants using immunoblot analysis with anti-SBT3.8 antibodies .
Immunohistochemistry: For visualizing SBT3.8 localization in plant tissues, particularly in root tissues where SBT3.8 functions in lateral root development.
Co-immunoprecipitation: Essential for investigating protein-protein interactions between SBT3.8 and its substrates, such as PSK precursors.
ELISA: For quantitative measurement of SBT3.8 levels across different tissues or treatment conditions.
When optimizing SBT3.8 antibody dilutions for Western blot experiments:
Start with a titration experiment using 1:500, 1:1000, and 1:2000 dilutions of primary antibody
Use recombinant SBT3.8 protein as a positive control (similar to the C-terminally hexa-His-tagged SBT3.8 described in the research)
Include sbt3.8 mutant tissue extracts as a negative control to confirm antibody specificity
For enhanced detection, consider using chemiluminescent substrates with varying exposure times
When working with SBT3.8-GFP fusion proteins, validate using both anti-SBT3.8 and anti-GFP antibodies to confirm expression, as was done in the SBT3.8ox transgenic plants
To differentiate between processed and unprocessed forms of SBT3.8 substrates like proPSK1:
Methodology:
Generate antibodies against specific epitopes that span the cleavage site in the PSK precursor
Design an immunodetection strategy using antibodies that recognize either:
The intact precursor form (spanning the cleavage junction)
The processed form (recognizing neo-epitopes created after cleavage)
Experimental approach:
Compare protein patterns from wild-type and sbt3.8 mutant extracts
Include recombinant proPSK1 and SBT3.8-processed proPSK1 as controls
For in vitro validation, use the digestion approach described in the research where recombinant proPSK1 was incubated with purified SBT3.8 and cleavage products were analyzed by SDS-PAGE
For more precise analysis, combine with mass spectrometry to identify specific cleavage products, similar to the approach that identified C-terminal processing of proPSK1 by SBT3.8
To investigate SBT3.8 substrate specificity in living plant tissues:
Recommended approach:
Generate transgenic lines expressing:
Use antibodies to track processing in:
Wild-type plants
sbt3.8 mutants
SBT3.8 overexpression lines (SBT3.8ox)
Complementary techniques:
Exudate incubation assays comparing wild-type and sbt3.8 mutant seedling exudates, which confirmed SBT3.8's role in processing both proPSK1 and proRGF1 in the research
Analysis of phenotypic rescue through application of mature peptides to mutant tissues, such as the application of PSK peptide to sbt3.8 mutants which improved lateral root development
For successful immunoprecipitation of SBT3.8-substrate complexes:
Antibody selection:
Crosslinking strategy:
Implement reversible crosslinking to capture transient enzyme-substrate interactions
Use low-temperature conditions to slow enzymatic processing
Controls and validation:
When investigating SBT3.8's role in stress responses, include these critical controls:
Essential controls:
Genetic controls:
Experimental controls:
Antibody controls:
Pre-immune serum control
Peptide competition assay to verify epitope specificity
Cross-reactivity assessment with related SBT family proteins
For effective immunolocalization of SBT3.8 in plant tissues:
Sample preparation protocol:
Carefully fix tissues using paraformaldehyde while preserving antigenicity
Use gentle cell wall digestion to improve antibody penetration
Block with 3-5% BSA containing 0.1% Triton X-100 to reduce background
Detection optimization:
For root tissues, where SBT3.8 functions in lateral root development, use thin sections (50-100 µm) to improve antibody access
Compare expression patterns in osmotic stress-treated vs. control seedlings
Consider dual immunostaining with markers for cell wall, Golgi, or secretory pathway components to determine precise subcellular localization
Include fluorescently tagged SBT3.8-GFP plants as positive controls, similar to the SBT3.8-sfGFP fusion described in the research
If experiencing variable SBT3.8 antibody signals:
Problem-solving approach:
Variable expression levels:
Technical considerations:
Optimize extraction buffers to effectively solubilize membrane-associated SBT3.8
Include protease inhibitors to prevent degradation during extraction
Consider epitope masking issues if working with SBT3.8 complexes
Alternative approaches:
Use SBT3.8-tag fusion proteins for detection with commercial tag antibodies
Combine with activity-based protein profiling to correlate protein levels with enzymatic activity
Consider mass spectrometry-based quantification for absolute quantification
Antibodies can reveal SBT3.8's function in drought stress signaling through:
Research approaches:
Signaling pathway analysis:
Immunoprecipitate SBT3.8 complexes from control and stressed tissues to identify interaction partners
Use phospho-specific antibodies to determine if SBT3.8 is regulated by stress-induced phosphorylation
Spatiotemporal dynamics:
Track SBT3.8 protein levels across different tissues during progressive drought stress
Correlate with PSK peptide production using custom antibodies against the mature PSK peptide
Compare with expression patterns of PSK receptor proteins
Translational implications:
To comprehensively analyze SBT3.8-dependent PSK processing:
Experimental design table:
Additional considerations:
Include site-directed PSK precursor mutants (D→A) to confirm Asp-dependence of processing in each tissue context
Supplement biochemical analyses with phenotypic assessments (lateral root development, fresh weight measurements) to correlate molecular changes with physiological outcomes
Compare with other known SBT3.8 substrates like proRGF1 to assess substrate preferences in different tissues
When facing discrepancies between SBT3.8 transcript and protein levels:
Analytical framework:
Post-transcriptional regulation:
Investigate microRNA-mediated regulation of SBT3.8 mRNA
Assess mRNA stability under different stress conditions
Post-translational mechanisms:
Examine protein turnover rates using cycloheximide chase experiments
Investigate if SBT3.8 undergoes self-processing or is targeted by other proteases
Consider stress-induced changes in protein stability or compartmentalization
Technical considerations:
Verify antibody is detecting all forms of SBT3.8 (precursor and mature)
Use multiple antibodies targeting different epitopes
Implement absolute quantification methods for both transcript (digital PCR) and protein (selected reaction monitoring mass spectrometry)
Biological interpretation:
Emerging antibody technologies could transform SBT3.8 research:
Single-cell proteomics:
Cell-type specific analysis of SBT3.8 expression and activity using highly sensitive antibody-based detection systems
Correlation with single-cell transcriptomics to identify regulatory mechanisms
In vivo biosensors:
Development of FRET-based sensors using anti-SBT3.8 antibody fragments to monitor conformational changes during activation
Creation of activity reporters based on PSK processing to visualize SBT3.8 activity in living cells
Proteome-wide substrate screening: