SCG2 Antibody

What is SCG2 and why is it important in research?

SCG2 (Secretogranin II, also known as Chromogranin C) is a neuroendocrine protein belonging to the chromogranin/secretogranin family that regulates the biogenesis of secretory granules. With a molecular weight of approximately 71 kDa and 617 amino acid residues in humans, this protein plays crucial roles in multiple biological processes. SCG2 is particularly important in research due to its involvement in tumor microenvironments, potential as a prognostic biomarker in colorectal cancer, and roles in neuronal function and development . Recent studies have also implicated SCG2 in neurodevelopmental disorders, making it a significant target for antibody-based detection in multiple research fields .

What applications are SCG2 antibodies validated for?

SCG2 antibodies have been extensively validated for multiple applications including:

It is recommended to optimize dilutions for each specific experimental system to obtain optimal results .

How should I select the appropriate SCG2 antibody for my research?

Selection of the appropriate SCG2 antibody depends on several factors:

• Experimental application: Ensure the antibody is validated for your specific application (WB, IHC, IF, etc.)

• Species reactivity: Confirm reactivity with your species of interest. Most SCG2 antibodies show reactivity with human, mouse, and rat samples

• Epitope recognition: Consider the region of SCG2 recognized by the antibody. Some antibodies target the N-terminal region (amino acids 1-200) , while others may target different regions

• Validation data: Review validation data and published applications. Some antibodies have been cited in multiple publications for specific applications

• Clonality: Consider whether a polyclonal or monoclonal antibody is more appropriate for your application based on sensitivity and specificity requirements

When studying SCG2 in neuronal or tumor samples, it's particularly important to select antibodies validated in those specific tissues .

What are the recommended protocols for SCG2 antibody use in immunohistochemistry?

For optimal IHC results with SCG2 antibodies:

• Tissue preparation: For formalin-fixed paraffin-embedded (FFPE) tissues, antigen retrieval with TE buffer pH 9.0 is recommended, although citrate buffer pH 6.0 can be used as an alternative

• Antibody dilution: Typically 1:50-1:500, but this should be optimized for your specific antibody and tissue

• Positive controls: Mouse pancreas tissue and human prostate cancer tissue have shown positive staining with SCG2 antibodies and can serve as positive controls

• Detection systems: Compatible with standard immunoperoxidase or fluorescent secondary detection systems

• Expected localization: SCG2 is mainly expressed in the cytoplasm of normal intestinal epithelial cells and shows relatively fewer SCG2-positive cells in malignant CRC tissues

For co-localization studies, confocal immunofluorescence microscopy has successfully shown co-localization of SCG2 with macrophages in tumor tissues .

What are common issues when using SCG2 antibodies in Western blotting?

Common challenges in Western blotting for SCG2 and their solutions include:

• Multiple bands: SCG2 has a predicted molecular weight of 71 kDa, but processing or post-translational modifications may result in additional bands. Validation using positive controls like SH-SY5Y cells is recommended

• Weak signal:

  • Increase antibody concentration (within recommended range: 1:500-1:1000)

  • Optimize protein loading (50 μg of brain lysate has shown good results)

  • Use enhanced chemiluminescence (ECL) technique for detection

• High background:

  • Increase blocking time or concentration

  • Use BSA instead of milk for blocking if phosphorylated epitopes are important

  • Ensure thorough washing between steps

• Sample preparation: Use 7.5% SDS PAGE for optimal separation in the 71 kDa region

When troubleshooting, refer to validated positive controls such as mouse brain lysate or SH-SY5Y cells which consistently show SCG2 expression .

How can I validate the specificity of SCG2 antibody staining in my samples?

To validate SCG2 antibody specificity:

• Positive and negative controls:

  • Positive tissues: Pancreas (mouse), prostate cancer tissue (human), and brain tissue have shown reliable SCG2 expression

  • Cell lines: SH-SY5Y cells show positive Western blot detection

  • Negative controls: Include isotype controls and tissue known to be negative for SCG2

• Knockdown/knockout validation:

  • Several publications have utilized SCG2 knockdown approaches to validate antibody specificity

  • When possible, include SCG2 knockdown samples as controls

• Multiple antibody validation:

  • Use antibodies from different sources or that recognize different epitopes

  • Compare staining patterns to ensure consistency

• RNA expression correlation:

  • Correlate protein detection with mRNA expression using qRT-PCR

  • The primer sequences GAPDH F-5′CTGGGCTACACTGAGCACC3′, R-5′AAGTGGTCGTTGAGGGCAATG3′, SCG2 F-5′ACCAGACCTCAGGTTGGAAAA3′, R-5′ACCAGACCTCAGGTTGGAAAA3′ have been successfully used

How can SCG2 antibodies be used to study tumor immune microenvironments?

SCG2 antibodies have proven valuable for studying tumor immune microenvironments through several sophisticated approaches:

• Co-localization studies: Confocal immunofluorescence microscopy demonstrates SCG2 co-localization with macrophages in tumor tissues but not in normal tissues, enabling visualization of SCG2's differential distribution in the tumor microenvironment

• Correlation with immune cell markers: SCG2 expression has been correlated with various tumor-infiltrating immune cell (TIIC) gene markers including:

  • T cell exhaustion markers (immune checkpoint genes)

  • Macrophage polarization markers (M1/M2)

  • Natural killer (NK) cells

  • Dendritic cells

  • Neutrophils

• Macrophage polarization analysis: SCG2 antibodies can help study the mechanism by which SCG2 influences M2 macrophage polarization in colorectal cancer, as SCG2 high expression is associated with increased M2 macrophage proportions

• Immune checkpoint correlation: Combined analysis with immune checkpoint markers (PD-1, PD-L1/2, CTLA-4, TIM-3, TIGIT) can reveal mechanisms of T cell exhaustion and potential immunotherapy targets

This approach has revealed that SCG2 high expression correlates with higher immune and stromal scores in colorectal cancer, suggesting its role in regulating tumor immunity .

What are the current applications of SCG2 antibodies in neurodevelopmental disorder research?

SCG2 antibodies are increasingly utilized in neurodevelopmental disorder research through several innovative approaches:

• Nanoplasmonic immunosensors: Highly sensitive nanoplasmonic immunosensors performing enzyme-linked immunosorbent assays (ELISA) on gold nanodot arrays have been developed to detect SCG2 in small volumes (as little as 5 μL) of serum from pediatric patients, enabling early detection of potential neurodevelopmental disorders

• Neuronal development studies: SCG2 antibodies have been used to examine how SCG2 levels impact:

  • Dendritic arborization

  • Synaptic formation

  • Neuronal differentiation

• Signal integration analysis: SCG2 antibodies help study how SCG2 functions as a signal integrator of glutamate and dopamine in hippocampal neurons, as Scg2 mRNA levels are elevated by these neurotransmitters while being lowered by GABA

• Biomarker validation: Research has shown higher serum SCG2 levels in pediatric patients with developmental delay compared to control groups, positioning SCG2 as a candidate biomarker for early diagnosis of neurodevelopmental disorders

These applications are particularly valuable because neurodevelopmental disorders can currently only be diagnosed at 2-3 years of age, while neural circuits are rapidly established around 6 months of age .

How do I interpret contradictory findings regarding SCG2 expression in different cancer types?

The literature shows apparently contradictory findings regarding SCG2 expression in cancer that require careful interpretation:

• Different expression patterns across cancer types:

  • In colorectal cancer (CRC), SCG2 has been reported as both decreased and increased in malignant tissues

  • The role of SCG2 varies between being a tumor suppressor in some contexts and a prognostic marker for poor outcomes in others

• Resolution of contradictions:

  • Heterogeneity within cancer types: Different CRC subtypes may show different SCG2 expression patterns

  • Staging differences: Expression may vary by cancer stage—SCG2 has been associated with advanced clinical stages in some studies

  • Methodological differences: Some studies assess mRNA expression (TCGA data) while others examine protein levels (IHC)

  • Functional versus prognostic significance: SCG2 can display tumor-suppressive functions even while serving as a marker of poor prognosis due to its roles in the tumor microenvironment

• Integrated analysis approach:

  • Combine analysis of SCG2 expression with mutation status (e.g., APC mutations show lower SCG2 expression)

  • Consider immune contexture alongside SCG2 expression—the "immune hot" subtype with high SCG2 expression may be more suitable for immunotherapy

  • Evaluate SCG2 in relation to chemotherapy response, as it has been identified in modules associated with treatment response

These nuanced interpretations suggest that SCG2's roles are context-dependent and may involve complex interactions with tumor immunity, stromal components, and treatment responses .

What cellular and subcellular distribution patterns can be expected when using SCG2 antibodies?

Understanding the expected cellular and subcellular distribution patterns of SCG2 is crucial for accurate interpretation of antibody staining:

• Tissue distribution:

  • Normal tissues: SCG2 is widely distributed in nervous and neuroendocrine tissues

  • Specific normal tissues with positive staining include:

    • Pancreas (mouse, human)

    • Prostate gland endocrine-paracrine cells

    • Adrenal gland

    • Colon epithelial cells

  • Malignant tissues: Variable expression with notable staining in:

    • Prostate cancer

    • Colorectal cancer (with differential expression compared to normal adjacent tissue)

• Subcellular localization:

  • Primary localization: Cytoplasmic staining is the predominant pattern

  • Secretory granules: As a regulator of secretory granule biogenesis, SCG2 is associated with these structures

  • Co-localization patterns: In tumor tissues, SCG2 shows co-localization with macrophages, which is not observed in normal tissues

• Distribution differences between normal and pathological states:

  • In normal intestinal tissues, SCG2 is mainly expressed in the cytoplasm of epithelial cells

  • In CRC tissues, there are relatively fewer SCG2-positive cells compared to adjacent normal tissues

  • The differential distribution pattern can be used to distinguish between normal and pathological states

These distribution patterns should be considered when validating antibody specificity and interpreting experimental results across different tissue and cell types.

How can SCG2 antibodies be employed in research on immunotherapy response prediction?

SCG2 antibodies offer promising applications for immunotherapy response prediction research:

• Immune checkpoint correlation analysis:

  • SCG2 expression positively correlates with immune checkpoint markers including PD-1, PD-L1/2, CTLA-4, TIM-3, and TIGIT in CRC patients

  • Using SCG2 antibodies in multiplex IHC with checkpoint markers could identify patients likely to respond to checkpoint inhibitor therapy

• Tumor microenvironment (TME) characterization:

  • SCG2 high expression is associated with higher immune and stromal scores based on ESTIMATE analysis

  • The SCG2 high expression subgroup displays the "immune hot" phenotype considered more suitable for immunotherapy

  • Antibody-based detection can help classify tumors by immune infiltration status

• Macrophage polarization assessment:

  • SCG2 promotes M2 macrophage polarization, which typically suppresses anti-tumor immunity

  • Using SCG2 antibodies alongside M1/M2 macrophage markers could predict immunosuppressive microenvironments that might resist checkpoint inhibition

• Methodological approach:

  • Combine SCG2 IHC with CIBERSORT analysis to correlate protein expression with predicted immune cell proportions

  • Compare SCG2 protein levels with M2 macrophage marker genes (CD163, VSIG4, MS4A4A) and TAM marker genes (CCL2, CD68, IL10)

  • Correlate findings with clinical response data to checkpoint inhibitors

Recent research indicates that SCG2 might serve as a promising biomarker to identify CRC patients who may benefit from immunotherapy, particularly those with high SCG2 expression showing features compatible with immunotherapy response .

What are the most promising technical advances in SCG2 detection methods?

Recent technical advances in SCG2 detection demonstrate significant innovation:

• Nanoplasmonic immunosensors:

  • Combine ELISA techniques with gold nanodot arrays

  • Employ tyramide signal amplification to achieve high sensitivity

  • Require minimal sample volume (only 5 μL of serum)

  • Enable detection of SCG2 as a potential biomarker for early diagnosis of neurodevelopmental disorders

• Advanced immunofluorescence techniques:

  • Confocal immunofluorescence microscopy for co-localization studies

  • Successfully demonstrated SCG2 co-localization with macrophages in tumor tissues but not in normal tissues

  • Provides spatial information about SCG2 distribution in the tumor microenvironment

• Integrated multi-omics approaches:

  • Combining antibody-based protein detection with:

    • Transcriptomic data (RNA-seq)

    • Mutation status analysis

    • Immune cell infiltration predictions (CIBERSORT)

  • Enables comprehensive understanding of SCG2 function in different contexts

• Antibody validation methods:

  • Use of knockdown/knockout approaches to confirm specificity

  • Multiple application validation (WB, IHC, IF, CoIP)

  • Cross-species reactivity testing (human, mouse, rat)

These advanced techniques are expanding research capabilities beyond traditional applications and enabling more sensitive and specific detection of SCG2 in diverse experimental and clinical settings.