SLC11A2 Antibody, FITC conjugated

What are the key specifications of commercially available SLC11A2 Antibody, FITC conjugated?

Several manufacturers produce FITC-conjugated SLC11A2 antibodies with varying specifications. These antibodies are typically:

• Developed in rabbit as polyclonal antibodies targeting human SLC11A2

• Recognized epitopes include the amino acid region 1-69 of human SLC11A2

• Cross-reactivity varies by product, with some showing reactivity in human, mouse, and rat samples

• Generally purified using Protein G methods with purity levels >95%

• Stored in preservative buffers containing components like glycerol (typically 50%) and PBS (pH 7.4)

• Supplied in 100 μg quantities

Researchers should verify specific product characteristics, including the binding domain and cross-reactivity, to ensure compatibility with their experimental systems.

How should researchers determine appropriate dilutions for SLC11A2 antibodies in different applications?

Dilution requirements vary significantly by application and specific antibody preparation. Based on manufacturer recommendations:

When working with FITC-conjugated antibodies specifically, researchers should:

• Begin with the manufacturer's recommended dilutions

• Perform titration experiments in their specific biological system to optimize signal-to-noise ratios

• Include appropriate negative controls to account for potential autofluorescence

• Document tissue-specific and application-specific optimal dilutions for reproducibility

• Consider that sample-dependent factors may require adjustments from standard protocols

What are best practices for using SLC11A2 antibodies in immunohistochemical studies?

For optimal immunohistochemical detection of SLC11A2, researchers should consider several critical methodological factors:

For FITC-conjugated antibodies specifically, researchers should employ appropriate anti-photobleaching mounting media and minimize exposure to light during processing.

How can SLC11A2 antibodies be effectively used in cancer research applications?

SLC11A2 has emerged as a promising biomarker and therapeutic target in cancer research, particularly for ovarian cancer . For researchers investigating SLC11A2 in cancer contexts:

• Expression Manipulation Models: Establish overexpression and knockdown models using techniques demonstrated in studies with OVCAR8 ovarian cancer cell lines. This involves:

  • Transfection with overexpression plasmids or knockdown siRNAs

  • Verification of manipulation efficiency via qPCR or Western blot

  • Specific siRNA target sequences such as GGAGGAATCTTGGTCCTTA, GTACCTGCATTCTGCCTTA, and GAGTGACTTTGCCAATGGA

  • qPCR primer sequences: F: ATCGGCTCAGACATGCAAGAA; R: TTCCGCAAGCCATATTTGTCC

• Functional Assays: Following transfection, conduct functional assays (e.g., colony formation assays) by plating approximately 1000 cells per well, culturing for 10-14 days, fixing with formalin, staining with crystal violet, and quantifying results using imaging software like ImageJ .

• Comparative Tissue Analysis: Analyze SLC11A2 expression across normal tissues (e.g., ovarian and fallopian tube) versus primary and metastatic cancer samples using immunohistochemistry .

• Serum Biomarker Studies: Measure SLC11A2 concentrations in patient serum using ELISA to evaluate its potential as a non-invasive biomarker, analyzing results against clinical diagnoses .

What techniques are recommended for evaluating SLC11A2 antibody specificity and validation?

Rigorous validation is essential for ensuring reliable results with SLC11A2 antibodies:

• Western Blot Validation:

  • Verify detection at the expected molecular weight range (60-70 kDa observed; calculated 62 kDa)

  • Include positive control samples with known SLC11A2 expression (e.g., HuH-7 cells, COLO 320 cells, Caco-2 cells, rat kidney tissue, SH-SY5Y cells, Neuro-2a cells)

  • Implement proper membrane sectioning based on protein markers—e.g., separating SLC11A2 (72kD) and β-actin (42kD) regions

• Genetic Manipulation Controls:

  • Validate antibody specificity using knockdown/knockout models where SLC11A2 expression is reduced or eliminated

  • Include appropriate vector controls in overexpression studies

• Cross-Reactivity Assessment:

  • Test across multiple species if cross-species applications are intended

  • Document reactivity variations between human, mouse, rat, pig, and chicken samples

• Fluorescence Controls for FITC-Conjugated Antibodies:

  • Include secondary-only controls to assess non-specific binding

  • Implement tissue autofluorescence controls, particularly for highly autofluorescent tissues

How should researchers address inconsistent results when using SLC11A2 Antibody, FITC conjugated?

When encountering inconsistent results with FITC-conjugated SLC11A2 antibodies, researchers should implement a systematic troubleshooting approach:

• Antibody Storage Assessment:

  • Verify proper storage conditions (-20°C as recommended)

  • Check for evidence of freeze-thaw cycles that may have degraded antibody quality

  • Examine preservative buffer integrity (typically PBS with 0.02% sodium azide and 50% glycerol at pH 7.3)

• Protocol Optimization by Application Type:

  • For Western Blot: Adjust protein loading (10-30μg), blocking conditions, and antibody incubation times

  • For IHC/IF: Test multiple antigen retrieval methods (TE buffer pH 9.0 vs. citrate buffer pH 6.0)

  • For all applications: Implement titration experiments across the recommended dilution ranges

• Sample-Specific Considerations:

  • Evaluate sample preparation methods, including protein extraction protocols for Western blot

  • Assess fixation parameters for tissue samples in IHC/IF applications

  • Consider developmental stage, treatment conditions, or disease state that may affect SLC11A2 expression

• Technical Controls:

  • Include positive control samples with documented SLC11A2 expression

  • Implement loading controls for Western blots (β-actin at 42kD)

  • Document fluorescence exposure parameters for reproducibility

When analyzing troubleshooting data, maintain detailed records of all protocol variations to identify critical parameters affecting antibody performance.

What are the key considerations when interpreting fluorescence data from FITC-conjugated SLC11A2 antibody experiments?

Interpreting fluorescence data from FITC-conjugated antibody experiments requires careful attention to several technical and biological factors:

• Signal Specificity Verification:

  • Compare staining patterns to published localization data for SLC11A2 (cell membrane, endosomal compartments)

  • Examine subcellular distribution patterns in relation to known SLC11A2 functions in iron transport

  • Validate unexpected localization patterns with alternative detection methods

• Quantitative Analysis Approaches:

  • For tissue sections: Implement systematic scoring methods accounting for both staining intensity and percentage of positive cells

  • For cell cultures: Use standardized image acquisition parameters and objective quantification via software like ImageJ

  • Account for tissue autofluorescence through appropriate background subtraction

• Comparative Expression Analysis:

  • When comparing samples (e.g., normal vs. cancer tissues), maintain identical acquisition parameters

  • Document exposure times, gain settings, and post-processing steps

  • Consider the dynamic range limitations of fluorescence detection

• Tissue-Specific Considerations:

  • Be aware that SLC11A2 expression varies significantly by tissue type, with documented expression in brain, small intestine, pancreas, and various cell lines

  • Account for non-specific binding in highly vascularized tissues

Rigorous statistical analysis should be applied when comparing experimental groups, with at least three biological replicates for quantitative comparisons.

How can researchers distinguish between specific and non-specific signals when using SLC11A2 antibodies in complex tissue samples?

Differentiating specific from non-specific signals is particularly challenging in complex tissues:

• Control Implementation Hierarchy:

  • Genetic controls: Use tissues/cells with confirmed SLC11A2 knockdown or knockout

  • Absorption controls: Pre-incubate antibody with immunizing peptide to block specific binding

  • Secondary-only controls: Omit primary antibody to assess secondary antibody non-specific binding

  • Isotype controls: Use non-targeted IgG from the same species (rabbit IgG)

• Signal Validation Through Multiple Approaches:

  • Confirm key findings using alternative detection methods (e.g., validate IF results with IHC or Western blot)

  • Employ alternative antibodies targeting different SLC11A2 epitopes

  • Correlate protein detection with mRNA expression data

• Technical Signal Optimization:

  • Adjust blocking protocols to reduce background (adjust BSA or serum concentration)

  • Optimize washing steps (duration, buffer composition, number of washes)

  • Fine-tune antibody concentration based on signal-to-noise ratio

• Tissue-Specific Considerations:

  • Be aware of endogenous peroxidase activity in certain tissues

  • Account for tissue autofluorescence, particularly in FITC's emission spectrum

  • Consider lipofuscin or other autofluorescent cellular components when interpreting results

How is SLC11A2 antibody research contributing to understanding iron-related pathologies?

SLC11A2 antibodies are enabling significant advances in understanding iron metabolism disorders:

• Subcellular Localization Studies:

  • FITC-conjugated antibodies allow real-time visualization of SLC11A2 trafficking in response to iron availability

  • Multiple validated cell models including HepG2, HuH-7, COLO 320, Caco-2, SH-SY5Y, and Neuro-2a cells provide systems for studying tissue-specific regulation

• Neurodegenerative Disease Research:

  • SLC11A2 detection in mouse brain tissue supports investigation of iron dysregulation in conditions like Parkinson's and Alzheimer's diseases

  • Visualization of SLC11A2 in neurons helps elucidate mechanisms of iron accumulation and potential therapeutic interventions

• Hepatic Iron Overload Mechanisms:

  • Antibody-based studies help clarify SLC11A2's role in hepatic iron accumulation and tissue iron distribution

  • This research provides insights into conditions like hemochromatosis and transfusion-dependent iron overload

• Erythropoiesis and Anemia Research:

  • Investigation of SLC11A2 in erythroid precursor cells illuminates mechanisms of iron incorporation during red blood cell development

  • These studies contribute to understanding iron-deficient erythropoiesis and potential therapeutic approaches

Future directions include developing therapeutic antibodies targeting SLC11A2 for iron-related disorders and expanding research into additional metal transport pathologies involving manganese, cobalt, and other divalent metals transported by SLC11A2.

What new methodologies are being developed for SLC11A2 detection in cancer research?

Recent advances in SLC11A2 cancer research methodologies include:

• Combined Protein-mRNA Detection Systems:

  • Integration of FITC-conjugated antibody staining with in situ hybridization for simultaneous protein and transcript detection

  • This approach enables correlation between transcriptional regulation and protein expression in tumor samples

• Serum Biomarker Development:

  • ELISA-based detection of circulating SLC11A2 in patient serum samples

  • Analysis using tools like MyCurveFit for standard curve generation and concentration calculation

  • Correlation of serum levels with clinical diagnoses to evaluate diagnostic potential

• Functional Manipulation Models:

  • Establishment of overexpression and knockdown systems in cancer cell lines (e.g., OVCAR8)

  • Quantification of colony formation and other functional parameters to assess SLC11A2's role in cancer progression

  • Integration of antibody-based detection with functional assays to correlate expression with phenotype

• Comparative Tissue Analysis Platforms:

  • Systematic comparison of SLC11A2 expression across normal tissues, primary tumors, and metastatic samples

  • Development of standardized scoring systems for prognostic/diagnostic application

  • Implementation of digital pathology approaches for objective quantification

These methodologies collectively advance our understanding of SLC11A2's potential as both a biomarker and therapeutic target in cancer, particularly ovarian cancer .

What considerations should researchers address when designing experiments to study SLC11A2 regulation under different physiological conditions?

Designing robust experiments to investigate SLC11A2 regulation requires careful attention to several physiological variables:

• Iron Status Manipulation:

  • Implement controlled iron loading and depletion protocols

  • Verify iron status using complementary measures (ferritin levels, transferrin saturation)

  • Document time-course of SLC11A2 expression changes in response to altered iron availability

• pH-Dependent Transport Mechanisms:

  • Account for SLC11A2's proton-coupled transport activity in experimental design

  • Include pH controls in transport studies

  • Consider how tissue/cellular pH variations might affect antibody binding and protein function

• Tissue-Specific Expression Patterns:

  • Design tissue panels including validated positive expression sites (brain, small intestine, pancreas)

  • Account for differential expression across cell types within heterogeneous tissues

  • Consider developmental stage-specific expression patterns

• Interaction with Other Metal Transport Systems:

  • Design experiments that address SLC11A2's role in transport of multiple metals (manganese, cobalt, cadmium, nickel, vanadium, lead)

  • Implement competition studies to assess preferential transport

  • Consider cross-talk with other iron transport proteins (transferrin receptor, ferritin, ferroportin)

• Disease State Considerations:

  • In cancer studies, account for tumor heterogeneity with appropriate sampling strategies

  • For iron overload/deficiency models, verify physiological relevance of experimental conditions

  • Consider how inflammation and oxidative stress affect SLC11A2 regulation

Each experimental design should include appropriate controls for antibody specificity, particularly when crossing species boundaries or studying tissues with limited validation data.