SNX10 Antibody

What is SNX10 and what cellular functions does it regulate?

SNX10 (Sorting Nexin 10) is a member of the sorting nexin family of cytoplasmic and membrane-associated proteins characterized by the presence of a phosphoinositide binding motif called PX domain . This protein plays several critical roles in cellular function:

• Involvement in intracellular trafficking and endocytosis processes

• Regulation of endosome homeostasis and endosomal trafficking

• Modulation of mitochondrial protein degradation through piecemeal mitophagy

• Negative regulation of OXPHOS machinery components degradation

• Potential role in intestinal epithelial barrier function

Mutations in SNX10 have been implicated in approximately 4% of all human autosomal recessive osteopetrosis (ARO) cases, a disorder characterized by reduced bone resorption by osteoclasts . The protein has a calculated molecular weight of 24 kDa and an observed molecular weight of 25 kDa in experimental conditions .

What are the common applications for SNX10 antibodies in experimental research?

SNX10 antibodies are versatile tools in molecular and cellular research with multiple validated applications:

When designing experiments, it's essential to optimize the antibody dilution for your specific sample type and experimental conditions. Many suppliers recommend titrating the antibody in each testing system to obtain optimal results, as reactivity can be sample-dependent .

How should I select an appropriate SNX10 antibody based on species reactivity?

Selecting an antibody with appropriate species reactivity is crucial for experimental success. Based on the search results, commercial SNX10 antibodies show varied reactivity profiles:

• Many available antibodies demonstrate cross-reactivity with human, mouse, and rat SNX10

• Some antibodies may have more limited species reactivity, so checking the manufacturer's specifications is essential

When working with non-standard model organisms, consider the evolutionary conservation of the SNX10 protein sequence across species. While the search results mention canine, porcine, and monkey orthologs , you should verify the degree of sequence homology in your species of interest against the immunogen sequence used to generate the antibody. For highly conserved regions, cross-reactivity is more likely even if not explicitly tested by the manufacturer.

Importantly, validation experiments such as Western blotting with positive controls from your species of interest are recommended before proceeding with more complex or time-consuming applications.

What are the recommended storage conditions for maintaining SNX10 antibody stability?

Proper storage is critical for maintaining antibody performance and extending shelf life. For SNX10 antibodies, the following storage guidelines are recommended:

• Store at -20°C as received

• Many SNX10 antibodies are supplied in PBS with 0.02% sodium azide and 50% glycerol at pH 7.3

• Antibodies in this formulation are typically stable for one year after receipt when stored properly

• For antibodies supplied at 1 mg/ml concentration, aliquoting is generally unnecessary for -20°C storage

• Some formulations (20μl sizes) may contain 0.1% BSA

To maximize stability and performance, avoid repeated freeze-thaw cycles by preparing working aliquots if you anticipate frequent use. When handling the antibody, always keep it on ice and return to -20°C storage promptly after use.

How can I generate and validate SNX10 knockout cell lines for antibody specificity testing?

Creating SNX10 knockout cell lines is a valuable approach for validating antibody specificity and studying SNX10 function. Based on the search results, CRISPR/Cas9 technology has been successfully employed to establish SNX10 knockout cell lines:

The following protocol has been validated for generating SNX10 knockout stable cell lines:

• sgRNA design: Use optimized CRISPR design tools (e.g., http://www.e-crisp.org/E-CRISP/) to design sgRNAs targeting the human SNX10 gene. A previously validated sgRNA sequence is GTGTCTGGGTTCGAGATCCT .

• Lentiviral vector construction: Develop lentivirus (Lenti-CAS9-sgRNA-puro) encoding Cas9 nuclease and the guide RNA targeting SNX10, along with a vector for wild-type control .

• Cell infection and selection:

  • Infect target cells (e.g., Caco-2 and HT-29 have been successfully used) with the lentivirus

  • After 72 hours, select stable knockout cells using 2.0 μg/ml of puromycin

• Validation of knockout efficiency:

  • Western blot analysis using your SNX10 antibody to confirm absence of the protein

  • Genomic DNA sequencing of the targeted region to confirm mutations

  • For functional validation, assess known SNX10-dependent processes

• Reintroduction experiments: To confirm phenotype specificity, reintroduce SNX10 using recombinant adenovirus vectors for SNX10 overexpression (Ad-SNX10) with appropriate controls (Ad-vector) .

This approach provides a robust system for antibody validation and functional studies of SNX10.

What experimental approaches can I use to investigate SNX10's role in mitochondrial dynamics and piecemeal mitophagy?

Recent research has identified SNX10 as a negative regulator of piecemeal mitophagy of OXPHOS machinery components . To investigate this role, consider the following experimental approaches:

• Subcellular localization studies:

  • Under normal conditions, examine SNX10 localization to early endocytic compartments using fluorescently tagged SNX10 or immunostaining with SNX10 antibodies

  • In hypoxia-mimicking conditions, track SNX10 relocalization to late endosomal structures containing mitochondrial proteins

  • Use co-immunostaining with mitochondrial markers (COX-IV, SAMM50) and autophagy proteins (SQSTM1/p62, LC3B)

• Mitochondrial protein turnover assays:

  • Measure turnover rates of mitochondrial proteins (particularly COX-IV) in wild-type versus SNX10-depleted cells

  • Use cycloheximide chase experiments with Western blot analysis to track protein degradation rates

  • Analyze changes in degradation patterns under various stressors (hypoxia, mitochondrial toxins)

• Mitochondrial function assessment:

  • Measure mitochondrial respiration using Seahorse XF analyzer or similar technology

  • Assess citrate synthase activity as a marker of mitochondrial mass

  • Evaluate ROS production using fluorescent probes

• In vivo validation:

  • Utilize zebrafish models lacking Snx10 to examine Cox-IV levels

  • Measure ROS levels and ROS-mediated cell death, particularly in brain tissue

These approaches will provide comprehensive insights into SNX10's regulatory role in mitochondrial dynamics and selective mitochondrial protein degradation through piecemeal mitophagy.

What are the recommended protocols for studying protein-protein interactions involving SNX10?

Investigating protein-protein interactions is crucial for understanding SNX10's functional network. The search results describe validated immunoprecipitation protocols:

• Plasmid-based pull-down experiments:

  • Transfect cells with tagged SNX10 constructs (e.g., FLAG-tagged SNX10)

  • Collect cell lysates using a suitable lysis buffer (50 mM Tris-HCl [pH 8.0], 150 mM sodium chloride, 0.1% lauryl sodium sulfate, protease inhibitors, and 1% NP-40)

  • Incubate on ice for 30 minutes, then centrifuge for 15 minutes at 13,000 g

  • Treat lysates with 30 μl of anti-FLAG M2 agarose beads at 4°C for 6 hours

  • Wash beads with lysis buffer three times

  • Elute bound proteins by boiling for 5 minutes with 2× loading buffer

  • Analyze samples by immunoblotting for potential interaction partners

• Endogenous immunoprecipitation:

  • Use antibodies against endogenous SNX10 or suspected interaction partners (e.g., anti-caspase-5, anti-PIKfyve)

  • Include appropriate controls such as anti-IgG

  • Follow the same protocol as for tagged pull-downs

• Proximity ligation assays:

  • For detecting in situ protein interactions with spatial resolution

  • Use primary antibodies from different species against SNX10 and potential interactors

  • Follow with species-specific secondary antibodies conjugated to oligonucleotides

  • Visualize interactions as fluorescent spots when proteins are in close proximity (<40 nm)

When interpreting results, consider that SNX10 has been shown to interact with components of multiple cellular pathways, including endocytic trafficking, autophagy, and inflammatory signaling .

How can I optimize immunostaining protocols to visualize SNX10 in relation to endosomal compartments?

Visualizing SNX10 in relation to endosomal compartments requires careful optimization of immunostaining protocols:

• Sample preparation:

  • For cultured cells: grow on glass coverslips, fix with 4% paraformaldehyde for 15 minutes at room temperature

  • For tissue sections: use fresh-frozen sections or paraffin-embedded sections with appropriate antigen retrieval

  • For paraffin-embedded tissues: antigen retrieval with TE buffer pH 9.0 is recommended; alternatively, citrate buffer pH 6.0 can be used

• Antibody selection and dilution:

  • For SNX10 detection: use validated antibodies at optimal dilutions (1:50-1:500 for IHC)

  • For endosomal markers: include antibodies against early endosome (EEA1), late endosome (Rab7), and recycling endosome (Rab11) markers

• Staining protocol optimization:

  • Block with appropriate serum (5-10%) to reduce background

  • Incubate with primary antibodies overnight at 4°C

  • Use fluorescently-labeled secondary antibodies appropriate for your microscopy setup

  • Include DAPI for nuclear counterstaining

• Specialized visualization techniques:

  • For high-resolution imaging: consider super-resolution microscopy techniques

  • For dynamic studies: live-cell imaging with fluorescently tagged SNX10 constructs

  • For colocalization analysis: use appropriate software (ImageJ with coloc plugins, Imaris, etc.)

• Controls and validation:

  • Include negative controls (secondary antibody only, isotype control)

  • Use SNX10 knockout cells as specificity controls

  • Validate subcellular localization with fractionation experiments

Based on current research, expect to observe SNX10 localization to early endocytic compartments in a PtdIns3P-dependent manner under normal conditions. Under stress conditions like hypoxia, look for relocalization to late endosomal structures containing mitochondrial proteins .

What approaches can be used to investigate SNX10's role in intestinal barrier function and inflammatory pathways?

Recent research has implicated SNX10 in intestinal epithelial barrier function and inflammatory processes . To investigate these roles, consider the following experimental approaches:

• Cell line models:

  • Utilize intestinal epithelial cell lines (Caco-2, HT-29) with SNX10 knockout or knockdown

  • Compare wild-type, SNX10-deficient, and SNX10-reintroduced cells to establish causality

  • Use CRISPR/Cas9 for stable knockout or siRNA for transient knockdown

• Barrier function assessment:

  • Measure transepithelial electrical resistance (TEER) in cell monolayers

  • Perform permeability assays using fluorescent tracers (FITC-dextran)

  • Assess tight junction protein expression and localization by Western blot and immunofluorescence

• Inflammatory pathway analysis:

  • Investigate LPS sensing mechanisms in SNX10-deficient cells

  • Examine caspase-4/5 activation as potential downstream effectors

  • Study PIKfyve interaction with SNX10 using co-immunoprecipitation

  • Measure inflammatory cytokine production using ELISA or multiplex assays

• Genetic interaction studies:

  • Perform siRNA knockdown of potential pathway components (caspase-4, caspase-5, PIKfyve) in SNX10-expressing and SNX10-deficient backgrounds

  • Use the following validated siRNA sequences:

    • CASP4_1: AAGUGGCCUCUUCACAGUCAU

    • CASP4_2: AAGAUUUCCUCACUGGUGUUU

    • CASP5_1: AUAGAACGAGCAACCUUGACAA

    • CASP5_2: CUACACUGUGGUUGACGAAAA

    • PIKFYVE: GGCACAAGCUAUAGCAAUU

• Therapeutic targeting assessment:

  • Evaluate potential therapeutic approaches targeting SNX10 for restoring intestinal epithelial barrier function

  • Test compounds that modulate SNX10 expression or function in relevant disease models

These approaches will provide comprehensive insights into SNX10's role in intestinal barrier regulation and inflammatory signaling, potentially revealing new therapeutic targets for inflammatory bowel disease and related conditions .

What are the critical parameters for Western blot optimization when using SNX10 antibodies?

Optimizing Western blot protocols for SNX10 detection requires attention to several critical parameters:

• Sample preparation:

  • For tissue samples: mouse and rat brain tissues have been validated as positive controls

  • For cultured cells: select appropriate lysis buffers containing protease inhibitors

  • Ensure complete protein denaturation with appropriate sample buffer and heating

• Loading and detection:

  • The observed molecular weight of SNX10 is approximately 25 kDa

  • Use 10-15% SDS-PAGE gels for optimal resolution in this molecular weight range

  • Load sufficient protein (20-50 μg of total protein per lane) to detect endogenous SNX10

• Antibody dilution and incubation:

  • The recommended dilution range for Western blot is 1:1000-1:8000 or 1:2000

  • Optimize primary antibody incubation time (overnight at 4°C is typically effective)

  • Use appropriate blocking solution (5% non-fat dry milk or BSA in TBST)

• Signal detection and troubleshooting:

  • For weak signals: increase antibody concentration, extend incubation time, or use enhanced detection systems

  • For high background: optimize blocking conditions, increase washing steps, or dilute antibody further

  • For multiple bands: validate specificity with knockout controls or peptide competition assays

Following these guidelines will help ensure specific and robust detection of SNX10 in Western blot applications.

What controls should be included when validating a new SNX10 antibody?

Thorough validation of a new SNX10 antibody requires inclusion of appropriate controls:

• Positive controls:

  • Use tissues or cell lines with known SNX10 expression (e.g., mouse/rat brain tissue)

  • Include recombinant SNX10 protein at known concentrations for sensitivity assessment

  • Positive control lysates from multiple species to confirm cross-reactivity claims

• Negative controls:

  • SNX10 knockout or knockdown samples generated using CRISPR/Cas9 or siRNA techniques

  • Tissues or cell lines with minimal or no SNX10 expression

  • Secondary antibody-only controls to assess non-specific binding

• Specificity controls:

  • Peptide competition assays using the immunogen peptide

  • Comparative analysis with multiple antibodies targeting different epitopes of SNX10

  • Mass spectrometry validation of immunoprecipitated proteins

• Application-specific controls:

  • For IHC: include isotype controls and tissues with known expression patterns

  • For ICC/IF: perform subcellular fractionation to confirm localization patterns

  • For co-IP: include IgG controls and reverse immunoprecipitation

Documenting these validation experiments thoroughly will provide confidence in subsequent experimental results and facilitate troubleshooting if issues arise.