snx10a Antibody

What is SNX10 and why is it important in research?

SNX10 (sorting nexin 10) is a member of the sorting nexin family of proteins, characterized by the presence of a phospholipid-binding PX domain. This 201-amino acid protein with a molecular weight of approximately 24 kDa plays crucial roles in endocytosis, protein trafficking, and endosomal function . SNX10 has emerged as a significant research target due to its involvement in diverse cellular processes including:

• Regulation of ciliogenesis in vitro and in vivo

• Modulation of mitochondrial protein degradation and mitophagy

• Endosomal trafficking and function maintenance

• Intestinal barrier function and inflammatory response

• Tumor suppression in colorectal cancer

Mutations in SNX10 have been identified in approximately 4% of cases of autosomal recessive osteopetrosis (ARO), a rare genetic disorder characterized by abnormally dense bone resulting from dysfunctional osteoclasts .

What types of SNX10 antibodies are available for research applications?

Multiple types of SNX10 antibodies are available from various suppliers, including:

Most commercially available SNX10 antibodies can detect the protein in human, mouse, and rat samples, with some showing broader cross-reactivity to other species . Working dilutions typically range from 1:1000-1:8000 for Western blot applications and 1:50-1:500 for immunohistochemistry .

How should I validate the specificity of my SNX10 antibody before experimental use?

Thorough validation of SNX10 antibodies is critical to ensure experimental reliability. A multi-step approach is recommended:

• Genetic Controls: Use SNX10 knockout (KO) cell lines or tissues as negative controls. The search results mention multiple studies that have generated SNX10 knockout models, including CRISPR-Cas9 generated SNX10 KO stable cell lines in Caco-2 and HT-29 cells .

• siRNA Verification: Transfect cells with SNX10-specific siRNAs and confirm antibody signal reduction by Western blot or immunofluorescence. Studies have shown successful knockdown with 80% inhibition of SNX10 at the mRNA level using targeted siRNAs .

• Recombinant Protein Controls: Run positive controls using recombinant SNX10 protein alongside your samples in Western blot applications.

• Cross-reactivity Assessment: Test the antibody against related sorting nexin family proteins to ensure specificity.

• Multiple Antibody Comparison: Compare results using antibodies from different sources or those targeting different epitopes of SNX10.

The expected molecular weight of approximately 24-25 kDa should be observed in Western blot applications .

Western Blot:

• Sample preparation: Lyse cells or tissues in RIPA buffer with protease inhibitors

• Load 20-30 μg of total protein per lane

• Use 10-12% SDS-PAGE gels for optimal separation

• Transfer to PVDF or nitrocellulose membrane

• Block with 5% non-fat milk in TBST

• Incubate with primary anti-SNX10 antibody at dilutions of 1:1000-1:8000

• Detect using appropriate secondary antibody and visualization system

• Expected band size: 24-25 kDa

Immunohistochemistry/Immunofluorescence:

• Fix samples with 4% paraformaldehyde

• Perform antigen retrieval with TE buffer (pH 9.0) or citrate buffer (pH 6.0)

• Block with normal serum

• Incubate with primary anti-SNX10 antibody at dilutions of 1:50-1:500

• Visualize using appropriate detection system

Co-Immunoprecipitation:

For protein interaction studies, Flag-tagged SNX10 has been successfully used to pull down interacting partners like SRC, active-SRC, and endosomal proteins .

How can I use SNX10 antibodies to study mitochondrial protein degradation pathways?

Recent research has revealed that SNX10 plays a role in regulating the clearance of mitochondrial proteins through mechanisms distinct from canonical autophagy . To investigate this pathway:

• Subcellular Fractionation with Immunoblotting:

  • Isolate mitochondrial, endosomal, and lysosomal fractions

  • Probe with anti-SNX10 antibody alongside markers for each organelle

  • Analyze the distribution of SNX10 across fractions

• Immunofluorescence Co-localization:

  • Stain cells with anti-SNX10 antibody and markers for:

    • Mitochondria (MitoTracker or anti-COX-IV antibody)

    • Autophagosomes (anti-LC3B antibody)

    • Late endosomes/lysosomes (anti-LAMP1 or anti-CD63 antibody)

  • Quantify co-localization under basal and induced mitophagy conditions

• Proximity Ligation Assay:

  • Use anti-SNX10 antibody paired with antibodies against mitochondrial proteins

  • Assess direct interactions between SNX10 and specific mitochondrial targets

• Immunoprecipitation-Mass Spectrometry:

  • Pull down SNX10 using validated antibodies

  • Identify associated mitochondrial proteins by mass spectrometry

Research has shown that SNX10 depletion reduces levels of mitochondrial proteins like COX-IV, TIMM23, and PDH, with the strongest effect on COX-IV . These effects persist even when treating cells with autophagy inhibitors, suggesting an autophagy-independent mechanism .

What are the best approaches for studying SNX10's role in ciliogenesis using antibodies?

SNX10 has been identified as a key regulator of ciliogenesis in vitro and in vivo . To investigate this function:

• Quantitative Analysis of Cilia Formation:

  • Induce ciliogenesis through serum starvation in appropriate cell lines

  • Stain for cilia markers (acetylated tubulin) and SNX10

  • Measure cilia formation rates in control vs. SNX10-depleted cells

  • Research has shown that SNX10 siRNA knockdown reduces ciliogenesis by 30-66%

• Super-resolution Microscopy:

  • Utilize high-resolution imaging techniques to locate SNX10 at the base of primary cilia

  • Co-stain with basal body markers to determine precise localization

• Interaction Analysis:

  • Perform co-immunoprecipitation using anti-SNX10 antibodies to pull down ciliary proteins

  • Western blot analysis to detect interactions with V-ATPase subunits and RAB8A, which have been implicated in SNX10-mediated ciliogenesis

• Live-cell Imaging:

  • Use fluorescently tagged anti-SNX10 antibodies for dynamic studies

  • Track SNX10 localization during different stages of cilia formation

How can I investigate SNX10's role in intestinal inflammation using antibodies?

SNX10 has been implicated in intestinal barrier function and inflammatory response regulation . For studying this aspect:

• Tissue-specific Expression Analysis:

  • Use immunohistochemistry with anti-SNX10 antibodies on intestinal tissue sections

  • Compare expression patterns between normal and inflamed tissues

  • Analyze correlation with inflammatory markers

• Cell-type Specific Localization:

  • Perform double immunofluorescence staining in intestinal tissues using:

    • Anti-SNX10 antibody

    • Markers for different intestinal cell types (epithelial cells, immune cells)

  • Determine which cell populations express SNX10

• Signaling Pathway Analysis:

  • Use Western blot with anti-SNX10 antibody alongside antibodies for:

    • Phosphorylated Lyn (p-Lyn)

    • STAT3 activation markers

    • E-cadherin

  • Research indicates SNX10 deficiency prevents Lyn phosphorylation and maintains E-cadherin expression

• Protein-Protein Interaction Studies:

  • Immunoprecipitate SNX10 from intestinal epithelial cells

  • Probe for interactions with Lyn, PIKfyve, and caspase-5

  • Treatment with the SNX10 inhibitor DC-SX029 has been shown to impair these interactions

Why might I observe multiple bands or unexpected molecular weights when using SNX10 antibodies?

Multiple bands or unexpected molecular weights in Western blot analysis can occur for several reasons:

• Post-translational Modifications: SNX10 may undergo phosphorylation or other modifications that alter its mobility on SDS-PAGE.

• Protein Degradation: Insufficient protease inhibition during sample preparation can lead to degradation products.

• Alternative Splicing: Potential isoforms of SNX10 may exist. The canonical form is 24 kDa , but variant isoforms may have different molecular weights.

• Cross-reactivity: The antibody may recognize related sorting nexin family proteins, which share the conserved PX domain.

• Species Differences: SNX10 from different species may show slight variations in molecular weight.

Recommendations:

• Include positive controls (recombinant SNX10 protein)

• Test multiple antibodies targeting different epitopes

• Use freshly prepared samples with appropriate protease inhibitors

• Perform peptide competition assays to confirm specificity

• Consider using genetic knockout controls to identify the specific band

How do I optimize immunofluorescence staining with SNX10 antibodies for co-localization studies?

For high-quality co-localization studies investigating SNX10's association with cellular compartments:

• Fixation Optimization:

  • Test both 4% paraformaldehyde and methanol fixation

  • PFA is typically better for membrane proteins while methanol may better preserve epitopes for some antibodies

• Antigen Retrieval Methods:

  • If using paraffin sections, test both TE buffer (pH 9.0) and citrate buffer (pH 6.0)

  • For cell lines, test with and without permeabilization using different detergents (0.1% Triton X-100, 0.1% saponin)

• Antibody Dilution Series:

  • Test a range of dilutions (1:50-1:500) to determine optimal signal-to-noise ratio

  • Include appropriate negative controls

• Sequential vs. Simultaneous Staining:

  • For co-localization studies, determine whether sequential or simultaneous antibody incubation yields better results

  • Sequential staining may reduce potential cross-reactivity between secondary antibodies

• Advanced Imaging Techniques:

  • Use confocal microscopy with appropriate controls for bleed-through

  • Consider super-resolution techniques (STED, STORM) for more precise co-localization assessment

  • Employ quantitative co-localization analysis using appropriate software

Research has successfully demonstrated co-localization of SNX10 with endosomal markers (RAB5, EEA1), mitochondrial markers (MitoTracker, COX-IV), and autophagy markers (LC3B) .

What are the most appropriate cellular and animal models for studying SNX10 function?

Based on published research, the following models have been successfully used:

Cell Lines:

• RCC10/VHL cells: Used in ciliogenesis studies

• U2OS: Used for endosomal trafficking and mitophagy studies

• Caco-2 and HT-29: Intestinal epithelial cell lines used for studies of intestinal barrier function

• HCT116: Colorectal cancer cell line used for studying SNX10's role in tumor suppression

Animal Models:

• Snx10 floxed mice: Generated for conditional knockout studies

• Vil1-cre × Snx10 fl/fl mice: Intestinal epithelium-specific Snx10 conditional knockout

• Il10−/− × Snx10 conditional knockout mice: Model for studying SNX10's role in inflammatory bowel diseases

• Zebrafish: Used to confirm the role of Snx10 in regulating mitochondrial proteins

Disease Models:

• AOM/DSS-induced colorectal cancer model in mice: Used to study SNX10's role in CRC tumorigenesis

• DSS-induced acute colitis in mice: Used to study SNX10's role in intestinal inflammation

How can I generate and validate SNX10 knockout or knockdown models for antibody specificity testing?

CRISPR-Cas9 Knockout:

• Design sgRNAs targeting exons of the SNX10 gene

  • Example sgRNA sequence: GTGTCTGGGTTCGAGATCCT

• Deliver Cas9 and sgRNA via lentiviral vectors

• Select puromycin-resistant clones (typically using 2.0 μg/ml puromycin)

• Validate knockout by:

  • Western blot using anti-SNX10 antibodies

  • qRT-PCR for SNX10 mRNA expression

  • Genomic DNA sequencing of the targeted region

siRNA Knockdown:

• Design multiple siRNA sequences targeting different regions of SNX10 mRNA

  • Published effective siRNAs have achieved >80% knockdown

• Transfect cells using Lipofectamine RNAiMAX or similar reagents

• Validate knockdown efficiency by:

  • qRT-PCR to measure SNX10 mRNA levels

  • Western blot using anti-SNX10 antibodies

Conditional Knockout Models:

• Use Snx10 floxed mice crossed with tissue-specific Cre lines

  • Example: Vil1-cre for intestinal epithelium-specific deletion

• Validate tissue-specific knockout by:

  • qRT-PCR analysis of tissue samples

  • Western blot using anti-SNX10 antibodies

  • Immunohistochemistry of tissue sections

These genetic models not only provide controls for antibody specificity testing but also enable functional studies of SNX10 in different contexts.

How can SNX10 antibodies be applied to study its role in diseases beyond osteopetrosis?

Recent research has implicated SNX10 in multiple diseases beyond osteopetrosis:

Cancer Research:

• Expression Analysis in Patient Samples:

  • Use immunohistochemistry with anti-SNX10 antibodies on tissue microarrays

  • Compare expression between tumor and adjacent normal tissues

  • Correlate with clinical parameters and prognosis

  • SNX10 has been implicated in gastric cancer, glioblastoma, and colorectal cancer

• Mechanistic Studies:

  • Investigate SNX10's interaction with SRC and recruitment to autophagosomes

  • Analyze SNX10's impact on STAT3 activation in cancer models

  • Western blot analysis of SNX10 alongside cancer signaling markers

Inflammatory Bowel Disease:

• Expression Correlation with Disease Severity:

  • Analyze SNX10 levels in patient biopsies using immunohistochemistry

  • SNX10 expression correlates with Crohn's disease severity in human and mouse models

• Mechanism Investigation:

  • Study SNX10's role in LPS sensing and intestinal barrier function

  • Examine interactions with inflammatory signaling pathways

Metabolic Disorders:

• Adipocyte Differentiation and Function:

  • Investigate SNX10's role in human adipocyte biology

  • Immunofluorescence analysis of SNX10 in adipose tissue

What are the latest methodological advances in studying SNX10's interactions with cellular organelles?

Recent technological advances have enabled more sophisticated analyses of SNX10's interactions:

• Live-Cell Super-Resolution Microscopy:

  • Track SNX10-positive vesicles in real-time using fluorescently tagged SNX10

  • Analyze interactions with mitochondria, endosomes, and autophagosomes

  • Research has visualized SNX10-EGFP and mScarlet-RAB5 positive vesicles containing mitochondrial material

• Proximity-Based Labeling:

  • Generate BioID or APEX2 fusions with SNX10

  • Identify proteins in proximity to SNX10 in different cellular compartments

  • This approach could reveal novel interaction partners beyond those already identified

• Single-Vesicle Analysis:

  • Isolate SNX10-positive vesicles using immunoaffinity purification

  • Characterize lipid and protein composition using mass spectrometry

  • Compare compositions under different conditions (e.g., basal vs. induced mitophagy)

• Correlative Light and Electron Microscopy (CLEM):

  • Combine immunofluorescence using anti-SNX10 antibodies with electron microscopy

  • Precisely localize SNX10 to specific subcellular structures at ultrastructural resolution

  • Research has used immunogold labeling to study EGFR-containing endosomes in SNX10-depleted cells

These advanced methodologies offer new opportunities to unravel SNX10's complex roles in cellular homeostasis and disease processes.

How should I interpret conflicting results when studying SNX10 using different antibodies?

When facing contradictory results with different SNX10 antibodies, consider the following systematic approach:

• Epitope Differences:

  • Map the epitopes recognized by each antibody

  • Different antibodies may recognize distinct domains (e.g., PX domain vs. other regions)

  • Some epitopes may be masked in certain protein complexes or conformations

• Validation Status:

  • Assess the validation evidence for each antibody

  • Prioritize results from antibodies validated using knockout controls

  • Some antibodies are verified on protein arrays containing the target plus 383 non-specific proteins

• Application Suitability:

  • Some antibodies perform well in WB but poorly in IF or IHC

  • Check if each antibody has been validated for your specific application

• Isoform Specificity:

  • Determine if antibodies might recognize different SNX10 isoforms

  • Review epitope locations relative to potential splice variants

• Experimental Context:

  • Cell-type specific differences in SNX10 modifications or interactions

  • Treatment conditions may affect epitope accessibility

• Resolution Strategies:

  • Use orthogonal methods to verify findings (e.g., mass spectrometry)

  • Generate epitope-tagged SNX10 constructs for validation

  • Conduct genetic knockdown/knockout experiments

How can I quantitatively assess SNX10's role in complex cellular processes?

Robust quantitative approaches are essential for understanding SNX10's functions:

• Colocalization Analysis:

  • Calculate Pearson's or Mander's coefficients for SNX10 colocalization with:

    • Endosomal markers (RAB5, EEA1)

    • Mitochondrial markers (MitoTracker, COX-IV)

    • Autophagy markers (LC3B)

  • Research has shown increased co-occurrence of LC3B-positive structures with SNX10 after DFP treatment

• Protein Degradation Kinetics:

  • Measure half-lives of mitochondrial proteins in control vs. SNX10-depleted cells

  • Pulse-chase experiments to track specific protein turnover

  • SNX10 depletion affects levels of TIMM23, PDH, and COX-IV, with significant effect on COX-IV

• Endosomal Trafficking Metrics:

  • Quantify EGF receptor degradation rates

  • Measure the size and number of EEA1-positive endosomes

  • SNX10 silencing increases the numbers of EEA1-positive puncta and results in smaller EGFR-containing endosomes

• Mitochondrial Function Assays:

  • Measure citrate synthase activity as a marker for mitochondrial abundance

  • Assess oxygen consumption rate (OCR) in control vs. SNX10-depleted cells

  • Quantify mitochondrial membrane potential using appropriate dyes

• Statistical Analysis:

  • Use appropriate statistical tests (t-test, ANOVA) for group comparisons

  • Apply multiple testing corrections for large-scale analyses

  • Present data with clear indications of statistical significance (e.g., P < 0.002)