The SPAC11D3.09 antibody (Product Code: CSB-PA889237XA01SXV) is a custom polyclonal antibody developed for detecting the protein encoded by the SPAC11D3.09 gene in fission yeast. Key specifications include:
Target Species: Schizosaccharomyces pombe (strain 972 / ATCC 24843)
UniProt ID: Q9P7J1
This antibody is part of a broader catalog of rare antibodies for fission yeast research, enabling studies on gene expression, protein localization, and functional genomics .
The SPAC11D3.09 gene is annotated as a predicted agmatinase, an enzyme involved in polyamine biosynthesis. Agmatinase catalyzes the conversion of agmatine to putrescine, a critical step in metabolic pathways linked to cell proliferation and stress responses .
Upf1-Mediated mRNA Regulation:
SPAC11D3.09 was identified as a putative target of Upf1, a central component of the nonsense-mediated mRNA decay (NMD) pathway. In upf1Δ mutants, SPAC11D3.09 mRNA levels increased significantly, suggesting Upf1 destabilizes its transcripts .
Functional Link to mRNA Stability:
Genome-wide mRNA stability assays revealed that SPAC11D3.09 transcripts are destabilized by Upf1, linking this gene to RNA quality control mechanisms .
| Primer Name | Sequence (5’ → 3’) | Purpose |
|---|---|---|
| 415.FWD | tacccctgagagtgcaggtt | SPAC11D3.09 forward |
| 416.REV | gagtttgatcccatccaagc | SPAC11D3.09 reverse |
| Strain | Genotype | Application |
|---|---|---|
| MR595 | upf1Δ + SPAC11D3.09::kanMX4 | mRNA stability assays |
| V2–14-D03 | SPAC11D3.09::kanMX4 | Phenotypic screening |
mRNA Decay Studies: Used to investigate Upf1’s role in NMD and its impact on agmatinase-related transcripts .
Metabolic Pathway Analysis: Facilitates studies on polyamine biosynthesis and cellular stress responses in fission yeast.
Protein Localization: Potential use in immunofluorescence or Western blotting to determine subcellular protein distribution.
While current data emphasize SPAC11D3.09’s role in RNA metabolism, further studies could explore:
Its interaction with other NMD components (e.g., Upf2/3).
Metabolic consequences of agmatinase dysregulation.
Cross-species conservation of its mRNA stability mechanisms.
SPAC11D3.09c is a gene in Schizosaccharomyces pombe (fission yeast) that has been identified as a binding target of the Upf1 protein under basal conditions . It appears to be part of a group of genes regulated by the nonsense-mediated mRNA decay (NMD) pathway, which is a highly conserved mechanism that eliminates mRNAs containing premature termination codons. Understanding SPAC11D3.09c's function contributes to our knowledge of gene expression regulation in eukaryotic systems, particularly in the context of RNA processing and quality control mechanisms.
Antibodies against SPAC11D3.09 serve as valuable tools for investigating protein expression, localization, and interactions within fission yeast cells. They enable researchers to detect and quantify the SPAC11D3.09 protein in various experimental contexts, facilitating studies on gene expression regulation, particularly in the context of the NMD pathway. These antibodies can be used in techniques such as Western blotting, immunoprecipitation, and immunofluorescence microscopy to gain insights into the protein's role in cellular processes.
SPAC11D3.09c has been identified as a direct binding target of Upf1, a key component of the nonsense-mediated mRNA decay (NMD) pathway . Upf1 is an RNA-binding protein that, together with Upf2 and Upf3, forms a complex that participates in NMD and other aspects of gene expression regulation. The binding of Upf1 to SPAC11D3.09c suggests that this gene may be regulated post-transcriptionally by the NMD machinery. Understanding this relationship is important for elucidating the broader regulatory networks involved in RNA quality control and gene expression in fission yeast.
For generating specific antibodies against SPAC11D3.09, researchers should consider a multi-step approach:
Antigen design: Select unique epitopes from the SPAC11D3.09 protein sequence that have low homology with other proteins to ensure specificity. Both peptide antigens (for specific domains) and recombinant protein antigens (for conformational epitopes) should be considered.
Expression system selection: For recombinant protein production, E. coli or insect cell expression systems can be used. For SPAC11D3.09, a His-tagged recombinant protein approach similar to that used for Rhb1 in fission yeast studies would be appropriate .
Immunization protocol: Immunize animals (typically rabbits or mice) with the purified antigen according to established protocols. For polyclonal antibodies, rabbits are often preferred, while monoclonal antibodies require mouse or rat immunization followed by hybridoma generation.
Antibody purification: Affinity purification using the immunizing antigen to isolate specific antibodies is essential for reducing background and increasing specificity.
Validating antibody specificity is crucial for reliable experimental results. For SPAC11D3.09 antibodies, implement the following validation steps:
Western blot analysis: Perform Western blotting using wild-type yeast lysates compared to SPAC11D3.09 deletion strains. A specific antibody should show a band of the expected molecular weight in wild-type but not in deletion strains.
Immunoprecipitation followed by mass spectrometry: Immunoprecipitate the protein using the antibody and confirm its identity by mass spectrometry analysis.
Immunofluorescence comparison: Compare immunofluorescence staining patterns between wild-type and deletion strains or strains with tagged versions of SPAC11D3.09.
Pre-absorption controls: Pre-incubate the antibody with excess purified antigen before immunolabeling to confirm that this abolishes specific staining.
RNA interference: Validate antibody specificity in cells where SPAC11D3.09 expression has been reduced through RNAi techniques.
For optimal preservation of SPAC11D3.09 antibody activity:
Temperature: Store antibodies at -20°C for long-term storage or at 2-8°C for short-term storage (similar to storage recommendations for other antibodies like the Mouse Anti-Mouse I-Ad antibody) .
Buffer composition: Use borate buffered saline (pH 8.2) or phosphate-buffered saline with stabilizing proteins (0.1% BSA or 50% glycerol).
Aliquoting: Divide antibody solutions into small aliquots to avoid repeated freeze-thaw cycles, which can degrade antibody activity.
Preservatives: Include sodium azide (0.02%) to prevent microbial contamination, unless the antibody will be used in applications where azide interferes (such as cell culture).
Documentation: Maintain detailed records of antibody production date, concentration, and freeze-thaw cycles to track potential degradation over time.
For optimal Western blotting with SPAC11D3.09 antibodies:
Sample preparation: Prepare total cell lysates from fission yeast cells using glass bead lysis in buffer containing 150 mM NaCl and 10 mM Tris-HCl (pH 7.0) with 0.5% Triton X-100 and 0.5% deoxycholate, as successfully used in fission yeast studies .
Protease inhibitors: Add 0.4 mM phenylmethylsulfonyl fluoride and 1× protease inhibitor cocktail to prevent protein degradation during extraction .
Gel percentage: Use 15% polyacrylamide gels for optimal resolution of the SPAC11D3.09 protein.
Blocking conditions: Block membranes with 5% non-fat dry milk in TBST for 1 hour at room temperature.
Antibody dilution: Start with 1:1000 dilution for primary antibody incubation (overnight at 4°C) and adjust based on signal strength.
Controls: Include wild-type and deletion strain lysates as positive and negative controls, respectively.
Detection system: Use an appropriate secondary antibody conjugated to HRP and detect using enhanced chemiluminescence.
For effective immunoprecipitation of SPAC11D3.09:
Lysate preparation: Prepare cell lysates in a buffer containing 150 mM NaCl, 10 mM Tris-HCl (pH 7.0), 0.5% Triton X-100, and protease inhibitors .
Antibody binding: Incubate cell lysates with SPAC11D3.09 antibody (typically 2-5 μg per sample) for 2-4 hours at 4°C.
Capture method: Add protein A/G beads to capture the antibody-antigen complexes and incubate for an additional 1-2 hours.
Washing steps: Wash the immunoprecipitates 3-5 times with lysis buffer to remove non-specifically bound proteins.
Elution options: Elute bound proteins using either SDS sample buffer for Western blot analysis or milder conditions for maintaining protein activity.
Co-immunoprecipitation: For studying protein interactions, modify the buffer conditions (consider lower detergent concentrations) to preserve protein-protein interactions.
For immunofluorescence microscopy of SPAC11D3.09 in fission yeast:
Cell fixation: Fix cells with 3.7% formaldehyde for 30 minutes at room temperature, followed by cell wall digestion with zymolyase or lysing enzymes.
Permeabilization: Permeabilize cells with 0.1% Triton X-100 in PBS for 5 minutes.
Blocking: Block non-specific binding sites with 5% BSA or normal goat serum in PBS for 1 hour.
Primary antibody incubation: Apply SPAC11D3.09 antibody diluted 1:100 to 1:500 in blocking buffer and incubate overnight at 4°C.
Secondary antibody selection: Use a fluorophore-conjugated secondary antibody appropriate for your detection system, such as goat anti-rabbit IgG conjugated with a fluorescent dye .
Nuclear counterstaining: Counterstain nuclei with DAPI at 1 μg/ml.
Mounting and imaging: Mount slides with anti-fade mounting medium and image using confocal or wide-field fluorescence microscopy.
| Issue | Possible Causes | Solutions |
|---|---|---|
| Weak or no signal in Western blot | Low protein expression, inefficient transfer, antibody degradation | Increase protein loading, optimize transfer conditions, use fresh antibody aliquot |
| High background in immunostaining | Insufficient blocking, high antibody concentration, cross-reactivity | Increase blocking time/concentration, dilute antibody further, pre-absorb with yeast lysates |
| Multiple bands in Western blot | Protein degradation, cross-reactivity, post-translational modifications | Add more protease inhibitors, perform specificity tests, use phosphatase treatment |
| Poor immunoprecipitation efficiency | Weak antibody-antigen binding, harsh buffer conditions | Increase antibody amount, optimize buffer composition, extend incubation time |
| Inconsistent results between experiments | Antibody batch variation, sample preparation differences | Standardize protocols, validate each antibody batch, prepare larger batches of samples |
Optimization of SPAC11D3.09 antibody concentrations requires systematic titration:
Western blotting: Test a dilution series (1:500, 1:1000, 1:2000, 1:5000) to identify the minimum concentration that gives a clear specific signal with minimal background. Optimal signal-to-noise ratio is more important than absolute signal strength.
Immunoprecipitation: Start with 2-5 μg antibody per sample and adjust based on precipitation efficiency. Perform pilot experiments with increasing antibody amounts (1, 2, 5, 10 μg) and analyze the amount of target protein recovered.
Immunofluorescence: Begin with 1:100 dilution and test serial dilutions (1:100, 1:200, 1:500, 1:1000) to determine the optimal concentration that provides specific staining with minimal background.
Flow cytometry: Initial testing at 1:50 to 1:100 is recommended, followed by titration to identify the concentration that gives the clearest separation between positive and negative populations.
Cross-application validation: Note that optimal concentrations often differ between applications due to differences in antigen accessibility and detection sensitivity.
To enhance specificity when detecting SPAC11D3.09 in complex samples:
Pre-adsorption: Incubate the antibody with lysates from SPAC11D3.09 deletion strains to remove antibodies that bind to other proteins.
Affinity purification: Further purify the antibody against immobilized recombinant SPAC11D3.09 protein to enrich for specific antibodies.
Blocking optimization: Test different blocking agents (BSA, milk, normal serum) and concentrations to reduce non-specific binding.
Detergent adjustment: Optimize detergent type and concentration in washing buffers to reduce background while maintaining specific signals.
Competitive binding assays: Include soluble SPAC11D3.09 peptide or protein in a control reaction to demonstrate signal specificity.
Sequential epitope exposure: For challenging samples, consider antigen retrieval methods or alternative fixation protocols that may better preserve or expose the relevant epitopes.
SPAC11D3.09 antibodies can be powerful tools for investigating NMD pathway regulation:
Protein interaction studies: Use co-immunoprecipitation with SPAC11D3.09 antibodies followed by mass spectrometry to identify interaction partners, particularly components of the NMD machinery like Upf1, Upf2, and Upf3 .
Chromatin immunoprecipitation (ChIP): If SPAC11D3.09 has nuclear functions, ChIP can be used to identify its DNA binding sites and potential role in transcriptional regulation.
RNA immunoprecipitation (RIP): Use SPAC11D3.09 antibodies to pull down associated RNA molecules to understand its role in RNA processing or stability.
Stress response experiments: Monitor SPAC11D3.09 protein levels and localization under various stress conditions, such as oxidative stress, which has been linked to Upf protein function in fission yeast .
Quantitative proteomics: Combine SPAC11D3.09 immunoprecipitation with tandem mass spectrometry to quantify dynamic changes in protein interactions under different conditions.
To investigate SPAC11D3.09's relationship with Upf1:
Binding site mapping: Use deletion mutants of SPAC11D3.09 in conjunction with immunoprecipitation to identify specific regions required for Upf1 interaction.
CRISPR-based genetic studies: Generate precise mutations in the SPAC11D3.09 gene to disrupt Upf1 binding and assess functional consequences.
In vitro binding assays: Perform pull-down experiments with recombinant SPAC11D3.09 and Upf1 proteins to characterize direct binding parameters.
Conditional expression systems: Develop strains with inducible SPAC11D3.09 expression to study the temporal aspects of its interaction with Upf1.
RNA stability assays: Compare the stability of SPAC11D3.09 mRNA in wild-type and Upf1-depleted cells to determine if it is directly regulated by NMD.
Localization studies: Use dual-color immunofluorescence to assess co-localization of SPAC11D3.09 and Upf1 under various cellular conditions.
SPAC11D3.09 antibodies can provide insights into mRNA splicing mechanisms:
Spliceosome component analysis: Use immunoprecipitation to determine if SPAC11D3.09 associates with spliceosome components, particularly if it has any connection to the U11/U12 splicing system known in other organisms .
Splicing assays: Combine SPAC11D3.09 depletion or overexpression with splicing reporter assays to assess its impact on alternative splicing patterns.
RNA-seq analysis: Compare transcriptome profiles between wild-type and SPAC11D3.09-mutant strains to identify splicing alterations, focusing on exon inclusion/exclusion events.
In vitro splicing reactions: Add or deplete SPAC11D3.09 from cell extracts to assess its direct role in splicing reactions using model pre-mRNA substrates.
Genetic interaction screens: Use SPAC11D3.09 mutants in combination with mutations in known splicing factors to identify functional relationships through synthetic genetic interactions.
For accurate quantification of SPAC11D3.09 expression:
Loading controls: Use established loading controls for fission yeast, such as tubulin detected with TAT-1 monoclonal antibody, as referenced in fission yeast studies .
Normalization procedures: Calculate relative expression by dividing the SPAC11D3.09 band intensity by the loading control band intensity.
Standard curves: Include a dilution series of a reference sample to ensure measurements fall within the linear range of detection.
Technical replicates: Perform at least three technical replicates for each biological sample to account for blotting and detection variability.
Densitometry software: Use specialized software (ImageJ, Image Lab, etc.) with consistent background subtraction methods across all analyzed blots.
Statistical analysis: Apply appropriate statistical tests (t-test, ANOVA) when comparing expression levels between experimental conditions.
When interpreting co-localization data:
Quantitative metrics: Calculate Pearson's or Mander's correlation coefficients rather than relying on visual assessment alone.
Resolution limits: Consider the resolution limits of light microscopy (~200 nm) when interpreting apparent co-localization, as proteins may appear co-localized even when physically separated.
Controls for random co-localization: Analyze the co-localization of SPAC11D3.09 with abundant proteins not expected to interact as negative controls.
Z-stack analysis: Perform complete z-stack imaging and 3D reconstruction to distinguish true co-localization from coincidental overlap in a single plane.
Super-resolution approaches: For detailed co-localization studies, consider super-resolution techniques (STED, PALM, STORM) that can resolve structures below the diffraction limit.
Time-lapse imaging: Assess the dynamics of co-localization over time, particularly in response to cellular stresses or cell cycle progression.
To differentiate specific from non-specific signals:
Genetic controls: Compare signals between wild-type and SPAC11D3.09 deletion strains as the most definitive control for specificity.
Competing peptide controls: Pre-incubate antibodies with the immunizing peptide/protein and demonstrate loss of specific signal.
Multiple antibodies: Validate results using multiple antibodies raised against different epitopes of SPAC11D3.09.
Signal characteristics: Assess whether the signal matches expected molecular weight, subcellular localization, and expression patterns.
Correlation with genetic manipulation: Confirm that signal intensity increases with overexpression and decreases with knockdown of SPAC11D3.09.
Signal-to-noise ratio assessment: Establish clear thresholds for distinguishing specific signals from background, based on controls and statistical analysis.