SRPK2 Antibody, FITC conjugated

What is SRPK2 and why is it an important research target?

SRPK2 (SRSF protein kinase 2) is a serine/arginine protein kinase that plays crucial roles in pre-mRNA splicing through phosphorylation of SR proteins. It functions as a key regulator of RNA processing and has been implicated in various pathological conditions. SRPK2 (EC 2.7.11.1) is also known as SFRS protein kinase 2 and serine/arginine-rich protein-specific kinase 2 . Recent research has demonstrated that SRPK2 is involved in cancer progression, particularly in melanoma, where its overexpression is associated with poor clinical outcomes . Additionally, SRPK2 has been implicated in neurodegenerative conditions through its role in microglial activation and beta-amyloid accumulation . The protein's multifaceted roles in both normal cellular function and disease processes make it a valuable research target for developing therapeutic interventions.

What are the standard applications for SRPK2 Antibody, FITC conjugated?

SRPK2 Antibody, FITC conjugated is versatile for multiple research applications:

The FITC conjugation enables direct visualization without the need for secondary antibodies, making it particularly valuable for immunofluorescence microscopy and flow cytometry applications. This antibody has been successfully used to detect SRPK2 cellular redistribution in response to various stimuli, including drug treatments . For optimal results, researchers should validate the appropriate dilution for their specific experimental system.

What are the optimal storage conditions for maintaining SRPK2 Antibody, FITC conjugated activity?

To maintain the functional integrity of SRPK2 Antibody, FITC conjugated:

• Store at -20°C for long-term storage (up to one year)

• For frequent use and short-term storage (up to one month), store at 4°C

• Upon receipt, aliquot the antibody to avoid repeated freeze-thaw cycles

• Store in the dark to prevent photobleaching of the FITC fluorophore

• The antibody is typically provided in a buffer containing 50% glycerol, 0.01M PBS (pH 7.4), and 0.03% Proclin 300 as a preservative

Studies have shown that improper storage can significantly reduce antibody performance. Repeated freeze-thaw cycles should be particularly avoided as they can lead to protein denaturation and subsequent loss of antibody specificity and sensitivity .

How should I design appropriate controls when using SRPK2 Antibody, FITC conjugated?

Robust experimental design requires several controls to ensure reliable interpretation of results:

• Negative controls:

  • Isotype control: Use a FITC-conjugated IgG from the same host species (rabbit) at the same concentration

  • Secondary antibody-only control (for indirect methods)

  • Untransfected/untreated cells to establish baseline expression

• Positive controls:

  • Cells with confirmed SRPK2 expression (e.g., HeLa cells)

  • Recombinant SRPK2 protein as a standard

  • Cells with enforced SRPK2 expression through transfection

• Specificity controls:

  • SRPK2 knockdown via siRNA to confirm signal reduction

  • CRISPR-Cas9 SRPK2 knockout cells

  • Blocking peptide competition assay

• Treatment validation controls:

  • SRPK inhibitors like SRPIN340 can be used to verify functional effects

  • ATM/CHK2 pathway modulators when studying nuclear translocation

Research has demonstrated that using SRPK2 knockout or knockdown controls is particularly important for validating antibody specificity, as shown in studies employing CRISPR-Cas9 genome targeting of SRPK2 in B16F10 cells .

What is the optimal protocol for detecting SRPK2 translocation using FITC-conjugated antibodies?

SRPK2 undergoes nuclear translocation under various conditions, including DNA damage responses. The following protocol has been validated for detecting SRPK2 translocation:

• Cell preparation:

  • Seed cells (e.g., 1 × 10^4 cells per well) on glass coverslips

  • Allow cells to adhere for 24 hours before treatment

  • Apply appropriate stimulus (e.g., cisplatin 15 μM)

• Fixation and permeabilization:

  • Fix cells with 4% paraformaldehyde in PBS for 20 minutes at room temperature

  • Quench excess aldehyde with 100 mM Tris-HCl pH 7.5

  • Permeabilize with 0.2% Triton X-100 in PBS for 10 minutes

• Blocking and antibody incubation:

  • Block with 0.5% fish skin gelatin (FSG) in PBS for 30 minutes

  • Incubate with SRPK2 Antibody, FITC conjugated (diluted appropriately) overnight at 4°C

  • Wash three times with PBS

• Nuclear counterstaining and mounting:

  • Counterstain nuclei with propidium iodide or DAPI

  • Mount coverslips with anti-fade mounting medium (0.01% p-phenylenediamine and 50% glycerol in PBS)

• Visualization and analysis:

  • Use confocal microscopy with appropriate excitation/emission settings

  • Quantify nuclear/cytoplasmic ratio using image analysis software (e.g., ImageJ)

This protocol has been shown to effectively detect SRPK2 translocation in response to treatments like cisplatin, with nuclear-to-cytoplasmic ratios serving as a quantitative measure of translocation efficiency .

How can I validate the specificity of SRPK2 Antibody, FITC conjugated in my experimental system?

Validating antibody specificity is critical for reliable interpretation of results. Multiple approaches should be combined:

• Western blot validation:

  • The antibody should detect bands at the expected molecular weight (77-78 kDa for the canonical form, with additional bands at 105-115 kDa for isoforms)

  • Compare with other validated anti-SRPK2 antibodies

  • Include positive control lysates (e.g., HeLa cells)

• Genetic validation:

  • Use SRPK2 siRNA knockdown to demonstrate signal reduction

  • Example approach: "Cells were transfected with 40 nM of SRPK2 siRNA using Lipofectamine 3000 according to manufacturer's instructions. At 24h post-transfection, western blotting was performed to assess transfection efficiency"

  • CRISPR-Cas9 genome targeting of SRPK2 using guide RNA sequences (e.g., AGGCTGTCTCTGTATAATGC)

• Recombinant protein controls:

  • Test antibody against recombinant SRPK2 protein

  • Verify interaction with immunoprecipitation followed by mass spectrometry

• Cross-reactivity assessment:

  • Test across multiple cell lines from relevant species

  • Verify expected subcellular localization patterns (predominantly cytoplasmic in unstimulated cells)

• Functional validation:

  • Correlate SRPK2 detection with functional assays (e.g., SR protein phosphorylation)

Research indicates that SRPK2 may present differently in various contexts, with observed molecular weights ranging from 77-115 kDa , highlighting the importance of thorough validation in each experimental system.

How can SRPK2 Antibody, FITC conjugated be used to study SRPK2's role in disease models?

SRPK2 Antibody, FITC conjugated provides valuable insights into disease mechanisms through several approaches:

• Cancer research applications:

  • Track SRPK2 expression and localization in melanoma and other cancer models

  • Studies have demonstrated that "SRPK2 expression in melanoma cells is associated with poor prognosis" and that "genetic targeting of SRPK2 impaired actin polymerization dynamics as well as the proliferative and invasive capacity of B16F10 cells"

  • Quantify changes in SRPK2 distribution during metastatic progression

• Neurodegenerative disease models:

  • Monitor SRPK2 in microglial activation studies

  • Research has shown that "enhanced SRPK2 expression contributed to the proinflammatory activation of microglia" suggesting "SRPK2 may be a key modulating pathway" in neuroinflammation

  • Track SRPK2 activation in relation to beta-amyloid accumulation

• Viral infection studies:

  • Examine SRPK2's role in viral replication

  • SRPK1 and SRPK2 have been identified "as the major cellular protein kinases phosphorylating HBV core protein"

  • Visualize SRPK2 redistribution during viral infection cycles

• RNA processing dysregulation:

  • Investigate how SRPK2 localization affects splicing patterns

  • Recent studies have uncovered a "BRD4-SRPK2-SRSF2 signal modulates the splicing efficiency" of certain genes

The FITC conjugation allows direct visualization of SRPK2 dynamics without secondary antibody steps, enabling more precise temporal and spatial analysis in live-cell imaging experiments when appropriate fixation protocols are employed.

What factors can affect SRPK2 detection using FITC-conjugated antibodies?

Several factors can influence the reliable detection of SRPK2:

• Phosphorylation state:

  • SRPK2 undergoes phosphorylation at multiple sites (e.g., T492), which can affect epitope accessibility

  • Research has shown that "Aβ triggered SRPK2 T492 phosphorylation, which is a marker for its activation"

  • Some antibodies may have differential recognition of phosphorylated vs. non-phosphorylated forms

• Subcellular localization shifts:

  • SRPK2 redistributes between cytoplasm and nucleus under various conditions

  • Studies demonstrate that treatments like cisplatin induce nuclear translocation of SRPK2

  • Inadequate permeabilization may limit detection in nuclear compartments

• Fixation and sample preparation:

  • Overfixation can mask epitopes and reduce signal

  • Different fixatives (paraformaldehyde vs. methanol) may affect epitope preservation

  • Cell-specific variations may require optimized protocols

• Expression levels:

  • SRPK2 expression varies across cell types and disease states

  • Overexpression in cancer cells may require adjusted antibody dilutions

  • Low expression may require signal amplification techniques

• Technical factors:

  • Photobleaching of FITC can reduce signal in prolonged imaging sessions

  • Background autofluorescence in the FITC channel

  • Buffer conditions can affect fluorophore performance

Research has demonstrated that "SRPK2 genetic targeting affects actin polymerization in B16F10 cells" and influences cellular morphology , which may indirectly affect antibody access to target epitopes.

How can I use SRPK2 Antibody, FITC conjugated in multiplex immunofluorescence with other markers?

Multiplex immunofluorescence strategies with SRPK2 Antibody, FITC conjugated require careful planning:

• Spectral compatibility:

  • FITC excites at ~495nm and emits at ~519nm (green channel)

  • Pair with fluorophores that have minimal spectral overlap, such as:

    • DAPI for nuclei (blue)

    • Rhodamine/Texas Red for cytoskeletal markers (red)

    • Far-red fluorophores (Cy5, Alexa 647) for additional targets

• Sequential staining approaches:

  • For multiple rabbit-derived antibodies, consider sequential staining with:

    • First primary antibody → first secondary → blocking → second primary antibody → second secondary

  • Use Fab fragments to block cross-reactivity between staining rounds

• Validated co-staining markers:

  • SR proteins (SRSF1, SRSF2) - substrate proteins for SRPK2

  • Nuclear speckle markers for co-localization (SC35)

  • Actin cytoskeleton markers (Rhodamine Phalloidin) - "SRPK2 genetic targeting impaired actin polymerization dynamics"

• Controls for multiplex imaging:

  • Single-color controls to establish bleed-through parameters

  • Isotype controls for each antibody species

  • Unstained samples to determine autofluorescence levels

• Image acquisition considerations:

  • Sequential scanning to minimize crosstalk

  • Matched exposure settings across experimental conditions

  • Z-stack acquisition for 3D localization analysis

Research has successfully combined SRPK2 antibody staining with F-actin visualization using Rhodamine Phalloidin, revealing that "SRPK2 genetic targeting impaired the formation of F-actin" , demonstrating the utility of multiplex approaches in understanding SRPK2's broader cellular functions.

How should I quantify and statistically analyze SRPK2 localization data from immunofluorescence experiments?

Rigorous quantification of SRPK2 localization requires systematic approaches:

• Nuclear-to-cytoplasmic ratio analysis:

  • Define nuclear regions using DNA counterstain (DAPI/propidium iodide)

  • Calculate mean fluorescence intensity in nuclear and cytoplasmic compartments

  • Express as nuclear-to-cytoplasmic ratio: "The nuclear-to-cytoplasmic SRPK2 ratios in the Western blots shown were quantified using ImageJ software"

• Colocalization analysis:

  • Calculate Pearson's or Mander's coefficients for SRPK2 with compartment markers

  • Use specialized plugins (e.g., JACoP in ImageJ) for quantification

  • Threshold controls should be included to define positive signals

• Population-level quantification:

  • Score cells as nuclear-dominant, cytoplasmic-dominant, or mixed

  • Count minimum of 50-100 cells per condition across 3+ biological replicates

  • Present data as percentage of cells in each category

• Statistical approaches:

  • For comparing two conditions: paired t-test or Mann-Whitney U (non-parametric)

  • For multiple conditions: ANOVA with appropriate post-hoc tests

  • Report exact p-values and include measures of dispersion (SD or SEM)

• Data presentation:

  • Include representative images alongside quantification

  • Use consistent scale bars and intensity settings

  • Present data in box-and-whisker plots or violin plots to show distribution

Example data table format for SRPK2 nuclear translocation quantification:

*p<0.05, **p<0.01 compared to control (ANOVA with Dunnett's post-hoc test)

This analytical approach has been validated in studies examining SRPK2 translocation in response to treatments such as cisplatin .

How can I address potential discrepancies between SRPK2 antibody detection methods?

When facing contradictory results between different detection methods:

• Cross-validation strategies:

  • Compare FITC-conjugated antibody results with unconjugated antibodies

  • Validate with alternative detection approaches (e.g., epitope-tagged SRPK2)

  • Use orthogonal techniques (Western blot, IP-MS) to verify observations

• Technical considerations:

  • Molecular weight discrepancies: "SRPK2 has observed molecular weight of 105-110 kDa" despite calculated weight of 78 kDa

  • Post-translational modifications can alter detection

  • Isoform specificity of different antibody clones

• Epitope accessibility issues:

  • Some epitopes may be masked in certain conformations or complexes

  • Fixation protocols can differentially affect epitope preservation

  • Protein-protein interactions may block antibody binding sites

• Methodology-specific artifacts:

  • WB detection may be affected by denaturation conditions

  • IF detection can be influenced by fixation/permeabilization protocols

  • ELISA may detect soluble forms differently than membrane-bound forms

• Resolution through combined approaches:

  • Subcellular fractionation followed by Western blotting can validate IF observations

  • "Cell fractionation procedure was employed to determine the distribution of SRPK2... SRPK2 was detected in cytoplasmic (Cyt) and nuclear (Nuc) extracts by Western blotting"

  • Co-immunoprecipitation can verify interaction partners observed in IF

When addressing discrepancies, researchers should consider that different antibody clones may recognize different epitopes, and that SRPK2 has been observed to undergo extensive post-translational modifications that affect its apparent molecular weight and detection properties .

How can I use SRPK2 Antibody, FITC conjugated to study the mechanism of SRPK2 inhibitors?

SRPK2 Antibody, FITC conjugated provides valuable tools for investigating inhibitor mechanisms:

• Inhibitor-induced localization changes:

  • Track SRPK2 subcellular distribution in response to inhibitors

  • Studies have used "SRPIN340 (SRPK1/2 inhibitor, 5–80 µM)" to examine effects on SRPK2 localization

  • Quantify changes in nuclear/cytoplasmic ratio following inhibitor treatment

• Interaction disruption analysis:

  • Visualize changes in SRPK2 co-localization with substrate proteins

  • Recent research has developed "a covalent protein-protein interaction inhibitor, C-DBS, that targets a lysine residue within the SRPK-specific docking groove"

  • Quantify reduced co-localization as evidence of interaction disruption

• Structure-function relationship studies:

  • Compare effects of ATP-competitive vs. protein-interaction inhibitors

  • "ATP-competitive kinase inhibitors must compete with the high intracellular concentration of ATP" while novel inhibitors target other domains

  • Correlate structural features with localization changes

• Functional readouts:

  • Combine SRPK2 visualization with downstream substrate phosphorylation

  • "Phosphorylation of their C-terminal RS domains by SR protein kinases (SRPKs) regulates their localization and diverse cellular activities"

  • Assess inhibitor specificity through differential effects on SRPK1 vs. SRPK2

• Time-course analysis:

  • Monitor temporal dynamics of inhibitor effects

  • Establish dose-response relationships for localization changes

  • Determine reversibility of inhibitor effects

Example experimental design for inhibitor study:

This approach leverages the direct visualization capabilities of FITC-conjugated antibodies to provide mechanistic insights into how different classes of inhibitors affect SRPK2 function and localization.

What are common issues when using SRPK2 Antibody, FITC conjugated and how can I address them?

Several technical challenges can arise when working with SRPK2 Antibody, FITC conjugated:

These troubleshooting approaches address common technical challenges and have been validated in multiple studies examining SRPK2 localization and function .

How can I optimize SRPK2 Antibody, FITC conjugated for detecting low expression levels?

Detecting low-abundance SRPK2 requires optimized protocols:

• Signal amplification strategies:

  • Tyramide signal amplification (TSA): Can increase sensitivity 10-100 fold

  • Increase antibody concentration: Test higher concentrations while monitoring background

  • Extended incubation: Overnight incubation at 4°C can enhance signal without increasing background

• Sample preparation optimization:

  • Gentle fixation: Over-fixation can mask epitopes; try 2% PFA for 10-15 minutes

  • Enhanced permeabilization: Methanol post-fixation can improve nuclear antigen access

  • Optimized antigen retrieval: Test both citrate buffer (pH 6.0) and TE buffer (pH 9.0)

• Imaging enhancements:

  • Confocal microscopy with photomultiplier gain optimization

  • Increased exposure time (with anti-bleaching precautions)

  • Deconvolution algorithms to improve signal-to-noise ratio

  • Z-stack acquisition and maximum intensity projection

• Enrichment approaches:

  • Subcellular fractionation to concentrate SRPK2 from specific compartments

  • Immunoprecipitation followed by immunofluorescence of the precipitate

  • Flow cytometry sorting of high-expressing populations before analysis

• Complementary validation:

  • Parallel detection with ultra-sensitive ELISA (1:5000-1:20000 dilution range)

  • Combine with transcript level assessment (RT-qPCR)

  • Consider reporter systems for very low expression scenarios

When optimizing for low expression, it's important to maintain appropriate controls to distinguish true signal from background. Studies have successfully detected endogenous SRPK2 across multiple cell types, confirming that optimization can yield reliable detection even at physiological expression levels .

What special considerations apply when using SRPK2 Antibody, FITC conjugated in different experimental systems?

Different experimental systems require tailored approaches:

• Cell line-specific considerations:

  • HeLa cells: Commonly used as positive controls for SRPK2 expression

  • Primary neurons: May require specialized fixation (e.g., 2% PFA + 0.1% glutaraldehyde)

  • B16F10 melanoma cells: Demonstrate high SRPK2 expression relevant to cancer studies

  • Microglia (BV2 cells): Show SRPK2-dependent phenotypic changes requiring specialized markers

• Tissue section analysis:

  • Thicker sections (>10μm): May require increased permeabilization time

  • Mouse brain tissue: "Positive IHC detected in mouse brain tissue"

  • Mouse testis tissue: "Positive IHC detected in mouse testis tissue"

  • Antigen retrieval: Critical for formalin-fixed paraffin-embedded (FFPE) tissues

• Species cross-reactivity:

  • Human: Primary target species for most commercial antibodies

  • Mouse: Confirmed reactivity in multiple studies

  • Rat: Some antibodies show cross-reactivity

  • Other species: Require validation due to epitope sequence variations

• 3D culture systems:

  • Increased antibody incubation times (24-48 hours)

  • Higher detergent concentrations for penetration

  • Confocal or light-sheet microscopy for 3D visualization

• Flow cytometry applications:

  • Gentler fixation to maintain cell integrity

  • Thorough titration to determine optimal concentration

  • Include appropriate fluorescence minus one (FMO) controls

Cross-validation between systems is recommended, as SRPK2 detection can vary significantly. Research has shown variable SRPK2 molecular weights (77-115 kDa) across different experimental systems , indicating possible system-specific post-translational modifications or isoform expression.