SRPK2 Antibody, HRP conjugated

What is SRPK2 and why is it significant in molecular research?

SRPK2 (Serine/arginine-rich protein-specific kinase 2) belongs to the protein kinase superfamily and plays crucial roles in cellular processes by phosphorylating RS domain-containing proteins such as SFRS1 and SFRS2 on serine residues. Its significance lies in its involvement in spliceosome assembly, splicing factor trafficking, and viral protein phosphorylation events. SRPK2 exhibits tissue-specific expression patterns, being highly expressed in brain, moderately in heart and skeletal muscle, and at lower levels in lung, liver, and kidney tissues . For researchers, this differential expression pattern provides important contextual information when designing experiments to study SRPK2 function in specific tissues or disease models.

What are the key experimental applications for SRPK2 Antibody, HRP conjugated?

The SRPK2 Antibody, HRP conjugated (e.g., catalog #bs-7923R-HRP) has been validated for several key applications including ELISA (1:500-1000 dilution), immunohistochemistry with paraffin-embedded tissues (IHC-P, 1:200-400 dilution), and immunohistochemistry with frozen sections (IHC-F, 1:100-500 dilution) . When designing experiments, researchers should consider that this antibody has confirmed reactivity with human and mouse SRPK2, with predicted reactivity across several other species including rat, dog, cow, sheep, pig, horse, chicken, and rabbit. For optimal results, validation should be performed when using this antibody in species or applications not explicitly tested by the manufacturer.

How should SRPK2 Antibody, HRP conjugated be stored to maintain optimal activity?

For maximum preservation of antibody activity, SRPK2 Antibody, HRP conjugated should be stored at -20°C and aliquoted into multiple vials to avoid repeated freeze-thaw cycles that can degrade protein structure and function . The storage buffer composition (aqueous buffered solution containing 0.01M TBS (pH 7.4) with 1% BSA, 0.03% Proclin300, and 50% Glycerol) is specifically formulated to maintain antibody stability and prevent microbial contamination. Researchers should track the number of freeze-thaw cycles each aliquot experiences and generally limit these to fewer than five to maintain consistent reactivity across experiments.

How does SRPK2 expression contribute to neuroinflammatory processes in Alzheimer's disease models?

Research indicates that enhanced SRPK2 expression plays a significant role in promoting proinflammatory activation of microglia, potentially serving as a key modulating pathway in Alzheimer's disease (AD) pathology . Studies have demonstrated that SRPK2 expression correlates with microglial phenotype polarization changes, characterized by increased expression of CD16/32 and IBA-1. BV2 cells with SRPK2 overexpression exhibited elevated levels of proinflammatory cytokines IL-6 and TNF-α, while showing decreased levels of anti-inflammatory cytokine IL-10. Furthermore, Aβ treatment promoted SRPK2 expression in BV2 cells, and SRPK2 deficiency mitigated the cytotoxic effects of Aβ or LPS+IFN-γ exposed microglia on HT22 cells. These findings suggest that targeting SRPK2 may represent a potential therapeutic approach for modulating neuroinflammation in AD .

What mechanisms link SRPK2 to cancer progression in melanoma and non-small cell lung cancer?

SRPK2 has been implicated in cancer progression through multiple mechanisms. In melanoma, single-cell RNA sequencing data analysis revealed that SRPK2 expression in melanoma cells correlates with poor prognosis . CRISPR-Cas9 genome targeting of SRPK2, but not SRPK1, impaired actin polymerization dynamics and reduced proliferative and invasive capacity of B16F10 melanoma cells . In non-small cell lung cancer (NSCLC), SRPK2 expression was upregulated in tumor tissues compared to adjacent normal tissues . Mechanistically, SRPK2 promotes neuronal apoptosis by upregulating cyclin-D1 expression through phosphorylation of SRSF2, which suppresses p53/TP53 phosphorylation and relieves its repressive effect on cyclin-D1 expression . Additionally, SRPK2 phosphorylates ACIN1 and redistributes it from nuclear speckles to the nucleoplasm, resulting in cyclin A1 upregulation . These findings suggest that SRPK2 represents a potential therapeutic target in multiple cancer types.

How does the Akt signaling pathway interact with SRPK2 expression and function in inflammatory responses?

Research has demonstrated a significant relationship between the Akt signaling pathway and SRPK2 expression in inflammatory contexts. Studies show that activated Akt pathway promotes the expression of SRPK2 in BV2 microglial cells . Experimental evidence reveals that knockdown of Akt expression (using siRNA transfection) alters SRPK2 levels, while treatment with Akt activators increases SRPK2 expression. This Akt-SRPK2 axis appears to modulate inflammatory responses, as SRPK2 expression levels directly affect the production of pro-inflammatory cytokines (IL-6, TNF-α) and anti-inflammatory cytokines (IL-10). The relationship between these pathways creates a mechanistic framework for understanding how cellular signaling cascades regulate inflammatory processes, particularly in neuroinflammatory conditions like Alzheimer's disease .

What are the optimal immunohistochemistry protocols for SRPK2 Antibody, HRP conjugated in different tissue types?

For optimal immunohistochemistry results with SRPK2 Antibody, HRP conjugated, tissue-specific protocol adjustments are necessary. For paraffin-embedded tissues (IHC-P), use a dilution of 1:200-400, employing heat-induced epitope retrieval (HIER) in citrate buffer (pH 6.0) for 20 minutes . For frozen sections (IHC-F), a higher dilution range of 1:100-500 is recommended with acetone fixation for 10 minutes at -20°C . When working with brain tissues, which exhibit high SRPK2 expression, reduce background staining by incorporating a blocking step with 5% normal serum from the same species as the secondary antibody for 1 hour. For tissues with lower SRPK2 expression (lung, liver, kidney), signal amplification using the avidin-biotin complex (ABC) method may improve detection sensitivity. Regardless of tissue type, always include positive controls (brain tissue sections) and negative controls (primary antibody omission) to validate staining specificity.

How can researchers optimize Western blotting procedures when using SRPK2 antibodies?

When performing Western blotting with SRPK2 antibodies, researchers should optimize several key parameters for reliable detection. First, use appropriate protein extraction buffers containing protease inhibitors and phosphatase inhibitors if phosphorylated forms are of interest . For SRPK2 detection, load 20-30 μg of protein per lane on 10% SDS-polyacrylamide gels, as SRPK2 has molecular weights of approximately 77 kDa and 115 kDa . Block membranes with 5% Bovine serum albumin (BSA) in Tris-HCl-buffered saline (TBS-T, 0.1% Tween-20) for 2 hours at room temperature to minimize background signal . When using HRP-conjugated SRPK2 antibodies, the recommended dilution for Western blotting is 1:1000 . For detection, use enhanced chemiluminescence (ECL) systems with appropriate exposure times to capture optimal signal while avoiding saturation. Always include β-actin (1:5000 dilution) as a loading control, and calculate the final results as the ratio of SRPK2 to β-actin expression .

What controls should be included when evaluating SRPK2 expression in experimental models?

To ensure experimental rigor when evaluating SRPK2 expression, researchers should implement a comprehensive set of controls. For knockdown or overexpression studies, include both negative controls (empty vectors, scrambled siRNA) and positive controls (known SRPK2 modulators like Akt activators) . When performing gene expression analysis via qRT-PCR, use reference genes like GAPDH for normalization, calculating relative gene expression as the ratio of target gene copy number to GAPDH mRNA copy number multiplied by 100 . For protein expression studies, technical validation should include concentration gradients of protein samples to confirm linearity of detection and antibody specificity tests using SRPK2 knockout/knockdown samples . In disease model studies, include appropriate time-course analyses, as SRPK2 expression may vary with disease progression. Additionally, spatial controls are important when studying tissues with heterogeneous SRPK2 expression, such as comparing nuclear versus cytoplasmic localization, which can provide insights into functional differences.

How should researchers design experiments to study SRPK2's role in neuroinflammatory processes?

Designing experiments to investigate SRPK2's role in neuroinflammatory processes requires a multi-faceted approach. Begin with in vitro models using microglial cell lines (like BV2) where SRPK2 expression can be manipulated through recombinant lentiviral vectors for overexpression or siRNA for knockdown . Challenge these modified cells with inflammatory stimuli such as Aβ or LPS+IFN-γ for 24 hours to simulate neuroinflammatory conditions. Assess inflammatory responses by measuring cytokine production (IL-6, TNF-α, IL-10) at both mRNA level using real-time qPCR and protein level using ELISA . For mechanistic studies, investigate the Akt-SRPK2 signaling axis by using Akt inhibitors or activators followed by Western blotting to detect phosphorylated forms of both proteins . To evaluate functional consequences, collect conditioned media from SRPK2-modified microglia and assess its effects on neuronal viability using cell lines like HT-22, measuring outcomes through cell viability assays such as WST-1 . Finally, validate key findings in more complex systems such as primary microglia cultures and in vivo models of neuroinflammation.

What are the methodological challenges in interpreting SRPK2 expression data across different experimental systems?

Interpreting SRPK2 expression data across experimental systems presents several methodological challenges. First, researchers must account for tissue-specific baseline expression patterns (high in brain, moderate in heart/muscle, low in lung/liver/kidney) . Different detection methods yield varying sensitivity and specificity profiles—Western blotting detects specific isoforms (77 kDa and 115 kDa proteins) , while immunohistochemistry provides spatial information but may suffer from cross-reactivity. When comparing across species, consider that while the antibody shows reactivity with human and mouse SRPK2, predicted reactivity in other species requires validation . Additionally, post-translational modifications (particularly phosphorylation states) significantly affect SRPK2 function but may not be captured by standard expression analyses. Environmental variables (cell culture conditions, animal housing) can influence SRPK2 expression levels, necessitating stringent standardization. Finally, when interpreting disease-related changes, researchers must differentiate between causative alterations in SRPK2 expression versus compensatory responses to pathological conditions.

How can researchers effectively combine genetic and pharmacological approaches to study SRPK2 function?

Effective investigation of SRPK2 function requires complementary genetic and pharmacological approaches. For genetic manipulation, implement CRISPR-Cas9 genome editing with carefully designed sgRNAs (e.g., targeting murine SRPK2: AGGCTGTCTCTGTATAATGC) to create knockout cell lines . For transient modulation, use siRNA-mediated knockdown with appropriate controls. Lentiviral vectors carrying SRPK2 coding sequences enable overexpression studies . Pharmacologically, identify compounds that specifically inhibit SRPK2 kinase activity and validate their specificity against related kinases (like SRPK1). Implement dose-response studies (IC50 determinations) and time-course analyses to characterize pharmacodynamic properties. For comprehensive understanding, combine approaches—for example, test pharmacological inhibitors in wild-type and genetically modified systems to distinguish on-target from off-target effects. In disease models, compare prophylactic versus therapeutic intervention timelines. Use rescue experiments where pharmacological inhibition is followed by genetic rescue with inhibitor-resistant SRPK2 variants to confirm specificity. This multi-modal strategy provides stronger mechanistic evidence than either approach alone.

What strategies can optimize the detection of phosphorylated SRPK2 in complex biological samples?

Detecting phosphorylated SRPK2 in complex biological samples requires specialized approaches for optimal results. Begin sample preparation with phosphatase inhibitor cocktails (including sodium orthovanadate, sodium fluoride, and β-glycerophosphate) in lysis buffers to preserve phosphorylation states . For enrichment of phosphoproteins prior to analysis, employ titanium dioxide (TiO2) or immobilized metal affinity chromatography (IMAC) techniques. When performing Western blotting, use phosphorylation site-specific antibodies (such as those targeting phosphorylated-SRPK2 at Thr492) and validate specificity using lambda phosphatase-treated controls. For signal amplification in low-abundance samples, consider using tyramide signal amplification (TSA) systems compatible with HRP-conjugated antibodies. Implement phos-tag SDS-PAGE to separate phosphorylated from non-phosphorylated SRPK2 isoforms based on mobility shifts. For tissue sections, use antigen retrieval methods optimized for phosphoepitope preservation, such as heat-induced epitope retrieval in EDTA buffer (pH 8.0). Lastly, consider mass spectrometry-based approaches for unbiased identification of novel phosphorylation sites on SRPK2.

How can researchers use SRPK2 Antibody, HRP conjugated in multiplex immunoassays?

Implementing SRPK2 Antibody, HRP conjugated in multiplex immunoassays requires careful optimization to maintain specificity while enabling simultaneous detection of multiple targets. For multiplex immunohistochemistry, employ sequential tyramide signal amplification (TSA) protocols, where the HRP-conjugated SRPK2 antibody (1:300 dilution) is applied first, followed by TSA-fluorophore deposition, microwave treatment to quench HRP activity, and subsequent antibody staining cycles . When designing antibody panels, pair SRPK2 detection with markers relevant to its function, such as CD16/32 and IBA-1 for microglia polarization studies , or SRSF1/SRSF2 for splicing regulation research. In microplate-based multiplex ELISAs, use the SRPK2 antibody at a 1:500 dilution and implement careful cross-reactivity testing with other detection antibodies in the panel . For bead-based multiplex assays, conjugate the SRPK2 antibody to spectrally distinct microspheres following manufacturer-recommended conjugation protocols. In all multiplex applications, include single-stain controls alongside multiplex samples to verify that antibody performance is not compromised in the multiplex context.

What are the technical considerations for using SRPK2 Antibody, HRP conjugated in flow cytometry applications?

While SRPK2 Antibody, HRP conjugated is not primarily marketed for flow cytometry, researchers can adapt it for this application with specific technical considerations. First, optimize cell fixation and permeabilization protocols, as SRPK2 has dual subcellular localization (cytoplasm and nucleus) . For intracellular staining, use 4% paraformaldehyde fixation followed by permeabilization with 0.1% Triton X-100 or commercially available permeabilization buffers. Dilute the HRP-conjugated antibody to 1:100-1:200 in flow cytometry staining buffer containing 1% BSA to reduce non-specific binding. Convert the HRP signal to fluorescence using fluorescent HRP substrates compatible with flow cytometry, such as eFluor™ 660 or Alexa Fluor™ tyramide reagents. Include appropriate compensation controls to account for spectral overlap when multiplexing. For validating specificity, use SRPK2 knockdown cells as negative controls and perform fluorescence-minus-one (FMO) controls. When analyzing subpopulations (e.g., activated versus resting microglia), incorporate surface markers into the panel prior to fixation and permeabilization steps. Finally, consider that detection of phosphorylated SRPK2 may require specialized phospho-flow protocols with alternative fixatives like BD Phosflow™ reagents.

How can researchers address common issues with non-specific binding when using SRPK2 Antibody, HRP conjugated?

Non-specific binding is a common challenge when working with SRPK2 Antibody, HRP conjugated. To mitigate this issue, implement a comprehensive blocking strategy using 5% BSA in TBS-T (0.1% Tween-20) for at least 2 hours at room temperature before antibody incubation . For tissues with high endogenous peroxidase activity (liver, kidney), include a peroxidase quenching step using 0.3% H2O2 in methanol for 30 minutes prior to primary antibody application. When working with neural tissues, add 0.1-0.3% Triton X-100 to the blocking solution to improve antibody penetration while reducing background. If non-specific binding persists, dilute the antibody in blocking buffer containing 1-5% normal serum from the same species as the tissue being examined. For particularly problematic samples, consider implementing a biotin/avidin blocking kit if endogenous biotin contributes to background. Always optimize antibody concentration through titration experiments (testing dilutions ranging from 1:100 to 1:1000) to identify the optimal signal-to-noise ratio for each experimental system . Additionally, include appropriate isotype controls (rabbit IgG at the same concentration) to distinguish specific from non-specific signals.

What quality control measures should be implemented when working with SRPK2 Antibody, HRP conjugated across different experimental batches?

Maintaining consistency across experimental batches requires rigorous quality control measures when working with SRPK2 Antibody, HRP conjugated. First, establish a reference standard using a well-characterized positive control sample (e.g., brain tissue lysate) and maintain aliquots for batch-to-batch comparisons . Implement regular validation testing of each new antibody lot using Western blotting to confirm the expected band pattern (77 kDa and 115 kDa) and intensity before use in critical experiments. For immunohistochemistry applications, process a standardized tissue microarray containing known SRPK2-positive and negative controls with each batch of experimental samples. Document and track key performance metrics including signal intensity, background levels, and signal-to-noise ratios across experiments. Standardize all experimental protocols including sample preparation, antibody dilutions, incubation times, and detection methods. Use automated systems where possible to minimize operator variability. For quantitative applications, include internal calibration standards and generate standard curves with each experimental run. Lastly, implement a laboratory information management system (LIMS) to track antibody lot numbers, storage conditions, freeze-thaw cycles, and performance metrics systematically.

How can researchers validate the specificity of SRPK2 Antibody, HRP conjugated in their experimental systems?

Validating antibody specificity is critical for reliable interpretation of SRPK2 research. Begin with genetic validation approaches using CRISPR-Cas9 or siRNA-mediated SRPK2 knockdown models to confirm signal reduction or elimination . Perform peptide competition assays by pre-incubating the antibody with the immunizing peptide (derived from human SRPK2 residues 266-350/688) prior to application, which should abolish specific binding. For cross-reactivity assessment, test the antibody in multiple species and compare expression patterns with published transcriptomic data. Implement orthogonal detection methods by correlating results from the HRP-conjugated antibody with independent SRPK2 detection approaches, such as mRNA quantification via qRT-PCR or mass spectrometry-based protein identification. For spatial specificity validation in immunohistochemistry, compare the subcellular localization pattern (cytoplasmic and nuclear) with published data on SRPK2 distribution. When evaluating functional effects of SRPK2 modulation, complement antibody-based detection with functional readouts such as changes in splicing patterns of known SRPK2 substrates. Finally, benchmark your antibody performance against published findings for consistency in expression patterns across tissues and experimental conditions.