STK11 Antibody

Shipped with Ice Packs
In Stock

Description

Definition and Mechanism

The STK11 antibody targets the serine/threonine kinase 11 protein, which activates downstream kinases such as AMPK to regulate metabolic pathways and tumor suppression. Mutations or loss of STK11 are associated with cancers (e.g., lung, breast) and Peutz-Jeghers syndrome . The antibody is used to study STK11 expression, localization, and prognostic significance in research and diagnostic settings.

Cancer Biology

  • Immune Microenvironment: STK11-mutant tumors exhibit reduced immune cell infiltration (e.g., CD8+ T cells) and lower PD-L1 expression, correlating with resistance to immune checkpoint inhibitors (ICIs) .

  • Drug Sensitivity: STK11 loss confers sensitivity to ERK/MEK inhibitors (e.g., trametinib) in EGFR-mutant lung cancer models, with synergistic effects when combined with osimertinib .

Therapeutic Targets

  • PDE4 Inhibition: Roflumilast, a PDE4 inhibitor, reduces migration and tumor growth in STK11-deficient pancreatic cancer cells, highlighting PDE pathways as therapeutic targets .

  • CoREST Inhibition: TNG260, in combination with pembrolizumab, is under investigation for STK11-mutated solid tumors (NCT# 23-414) .

Clinical Applications

  • Diagnostic Use: The antibody aids in identifying STK11 protein levels in tumor biopsies, guiding personalized therapies (e.g., ICIs, MEK inhibitors) .

  • Biomarker Development: STK11 status is being explored as a predictive marker for immunotherapy response in KRAS-mutant NSCLC .

Product Specs

Buffer
Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4
Form
Liquid
Lead Time
Made-to-order (12-14 weeks)
Synonyms
hLKB1 antibody; Liver kinase B1 antibody; LKB1 antibody; PJS antibody; Polarization related protein LKB1 antibody; Renal carcinoma antigen NY-REN-19 antibody; Serine/Threonine Kinase 11 antibody; Serine/threonine protein kinase 11 antibody; Serine/threonine protein kinase LKB1 antibody; Serine/threonine protein kinase STK11 antibody; Serine/threonine-protein kinase 11 antibody; Serine/threonine-protein kinase LKB1 antibody; Serine/threonine-protein kinase XEEK1 antibody; Stk11 antibody; STK11_HUMAN antibody
Target Names
Uniprot No.

Target Background

Function
STK11, also known as Liver Kinase B1 (LKB1), is a tumor suppressor serine/threonine-protein kinase that plays a critical role in regulating cellular energy homeostasis, growth, and survival. It functions by controlling the activity of AMP-activated protein kinase (AMPK) family members, which are involved in various cellular processes, including metabolism, polarity, apoptosis, and DNA damage response.

STK11 phosphorylates the T-loop of AMPK family proteins, promoting their activation. This phosphorylation event enhances the activity of several key kinases, including PRKAA1, PRKAA2, BRSK1, BRSK2, MARK1, MARK2, MARK3, MARK4, NUAK1, NUAK2, SIK1, SIK2, SIK3, and SNRK. It is important to note that STK11 does not phosphorylate MELK.

Beyond its role in AMPK regulation, STK11 also phosphorylates non-AMPK family proteins such as STRADA, PTEN, and possibly p53/TP53. This expands its influence on a wider range of cellular processes.

As a key upstream regulator of AMPK, STK11 mediates the phosphorylation and activation of AMPK catalytic subunits PRKAA1 and PRKAA2. Through this mechanism, it regulates various cellular functions, including:

- Inhibition of signaling pathways that promote cell growth and proliferation under energy-deprived conditions.
- Glucose homeostasis in the liver.
- Activation of autophagy during nutrient deprivation.
- B-cell differentiation in the germinal center in response to DNA damage.

STK11 is also a regulator of cellular polarity, playing a role in remodeling the actin cytoskeleton. Specifically, it is required for cortical neuron polarization by mediating the phosphorylation and activation of BRSK1 and BRSK2, leading to axon initiation and specification.

Furthermore, STK11 participates in the DNA damage response. It interacts with p53/TP53 and is recruited to the CDKN1A/WAF1 promoter to facilitate transcription activation. While STK11 can phosphorylate p53/TP53, the relevance of this phosphorylation in vivo is unclear and may be indirect, possibly mediated by the downstream STK11/LKB1 kinase NUAK1.

STK11 is also involved in p53/TP53-dependent apoptosis. It interacts with p53/TP53 and translocates to the mitochondrion during apoptosis, regulating p53/TP53-dependent apoptotic pathways. Additionally, STK11 mediates UV radiation-induced DNA damage response through CDKN1A. In conjunction with NUAK1, it phosphorylates CDKN1A in response to UV radiation, contributing to its degradation. This degradation is essential for optimal DNA repair. STK11 is also implicated in spermiogenesis.

Gene References Into Functions
  1. WIPI3 and WIPI4 beta-propellers have roles as scaffolds for LKB1-AMPK-TSC signaling circuits in the control of autophagy. PMID: 28561066
  2. The function of human LKB1 depends on membrane binding. LKB1 is down-regulated in malignant melanoma. PMID: 28649994
  3. LKB1 expression was abnormally reduced in >80% of gallbladder carcinoma (GBC) tissues, and the downregulation of LKB1 mRNA expression was associated with the poor prognosis of patients with GBC. PMID: 30015925
  4. Low LKB1 expression is associated with prostate cancer. PMID: 29566977
  5. Decreases in LKB1 expression by HBx protein-mediated p53 inactivation may play an important role in HBV-associated hepatocellular tumorigenesis. PMID: 29475611
  6. LKB1 performed as a tumor suppressor in lung cancer inhibiting proliferation of lung cancer cells and inducing their apoptosis. LKB1 also inhibited the in vivo growth of lung cancer. After treatment with cyclopamine, the activated Shh signaling pathway induced by LKB1 silencing was suppressed, and the inactivated Shh signaling pathway induced by LKB1 over-expression was enhanced. PMID: 29573522
  7. Cytoplasmic LKB1 promotes the growth of lung adenocarcinoma and could be a prognostic marker for lung adenocarcinoma. PMID: 30033530
  8. Here we report a novel frameshift mutation of STK11 in a Chinese Peutz-Jeghers syndrome family. PMID: 29301733
  9. findings demonstrate that LKB1 plays an important role in the maintenance of LSCs, which may be responsible for drug resistance and AML relapse PMID: 28397012
  10. STK11 mutation found in duodenal adenomas/adenocarcinoma highlight the importance of proteins encoded by these genes in tumor development. PMID: 29525853
  11. Study revealed a new role for LKB1 in promoting cell motility by downregulating migration-suppressing miRNA expression and exosome secretion. PMID: 29138862
  12. In our cohort enriched for advanced NSCLC patients who received platinum-based chemotherapy, STK11 mutations were not specifically associated with clinico-pathological features and they did not impact upon survival. PMID: 29191602
  13. Study found that ablation of Lkb1 in adipocytes induced inflammation and macrophage invasion in sciatic nerves, leading to severe sciatic axon abnormality and hindlimb paralysis. PMID: 29032027
  14. Data indicate that LKB1 is a potential suppressor of metastasis of pancreatic ductal carcinoma (PDC). Furthermore, results demonstrate that LKB1 promotes Snail protein degradation though enhancing interaction between E3 ligase FBXL14 and Snail to increase Snail ubiquitination. PMID: 29601127
  15. Ex vivo models showed that MDA-MB-231, a mesenchymal tumor cell line, grew in suspension only if LKB1 was upregulated, but the MCF-7 epithelial cell line lost its ability to generate spheroids and colonies when LKB1 was inhibited, supporting the idea that LKB1 might be necessary for circulating tumor cells to overcome the absence of the extracellular matrix during the early phases of intravasation. PMID: 28700115
  16. we speculate that YAP/TAZ in dependent of FOS may promote DNMT1 and subsequently mediate DNMT1-G9A complex involving serine metabolism and the methylation of DNA and histone. We hope that our study will stimulate further studies and a new targeted therapy and early medical intervention for YAP/TAZ could be a useful option for breast cancer cases complicated with LKB1 deficiency. PMID: 28931725
  17. Results show that STK11 mutation is a biomarker for responsiveness to cardiac glycosides (CGs). PMID: 27431571
  18. Data suggest that the hereditary Peutz-Jeghers syndrome (PJS) in the family may be attributed to the serine/threonine kinase 11 (STK11) gene missense mutation detected in both daughter and mother. PMID: 29419869
  19. LKB1 expression promoted an adaptive response to energy stress induced by anchorage-independent growth. Finally, this diminished adaptability sensitized LKB1-deficient cells to combinatorial inhibition of mitochondrial complex I and glutaminase. PMID: 28034771
  20. these data uncover that ADIPOQ/adiponectin induces autophagic cell death in breast cancer and provide in vitro and in vivo evidence for the integral role of STK11/LKB1-AMPK-ULK1 axis in ADIPOQ/adiponectin-mediated cytotoxic autophagy. PMID: 28696138
  21. Our data hint at a possible predictive impact of LKB1 expression in patients with aNSCLC treated with chemotherapy plus bevacizumab. PMID: 28119362
  22. Our results indicate that LKB1 Phe354Leu polymorphism may play an important role in leukemogenesis and represents a poor prognostic factor. PMID: 28882949
  23. we have demonstrated a novel function of LKB1 in DNA damage response. Cancer cells lacking LKB1 are more susceptible to DNA damage-based therapy and, in particular, to drugs that further impair DNA repair, such as PARP inhibitors. PMID: 27705915
  24. LKB1 overexpression inhibited apoptosis and activated autophagy of Eca109 cells following radiation treatment, as determined by flow cytometry and western blot analyses. PMID: 28656285
  25. In this study, compound heterozygous variants of LKB1, c.890G > A/ c.1062C > G and del(exon1)/ c.1062C > G, were identified in two sporadic Chinese Peutz-Jeghers syndrome cases PMID: 28185117
  26. By downregulating acetylated LKB1 protein via HERC2, SIRT1 fine-tunes the crosstalk between endothelial and vascular smooth muscle cells to prevent adverse arterial remodeling and maintain vascular homeostasis PMID: 27259994
  27. Data indicate that nesfatin-1/NUCB-2 enhanced migration, invasion and epithelial-mesenchymal transition (EMT) in colon cancer cells through LKB1/AMPK/TORC1/ZEB1 pathways in vitro and in vivo. PMID: 27150059
  28. STK11 sequence deletions and point mutations were found in 11 Chinese children with Peutz-Jeghers syndrome. PMID: 27467201
  29. define a CIII-PI3K-regulated endosomal signalling platform from which LKB1 directs epithelial polarity, the dysregulation of which endows LKB1 with tumour-promoting properties PMID: 29084199
  30. Structure of the complex of phosphorylated liver kinase B1 and 14-3-3zeta has been reported. PMID: 28368277
  31. a novel de-novo germline mutation is associated with Peutz-Jeghers syndrome and elevated cancer risk PMID: 29141581
  32. STK11 mutation is associated with Lung Adenocarcinoma. PMID: 26917230
  33. Case Report: novel heterozygous mutation (c.426-448delCGTGCCGGAGAAGCGTTTCCCAG,p.S142SfsX13) in the STK11 gene causing PJS in a Chinese female without a Peutz-Jeghers syndrome family history. PMID: 28986664
  34. Low LKB1 expression is associated with non-small cell lung cancer. PMID: 28652249
  35. Macrophage LKB1 reduction caused by oxidized low-density lipoprotein promotes foam cell formation and the progression of atherosclerosis. PMID: 28827412
  36. CPS1 maintains pyrimidine pools and DNA synthesis in KRAS/LKB1-mutant lung cancer cells PMID: 28538732
  37. All together our results show that STK11ex1-2 mutations delineate an aggressive subtype of lung cancer for which a targeted treatment through STK11 inhibition might offer new opportunities. PMID: 26625312
  38. Low LKB1 expression is associated with HPV-associated cervical cancer progression. PMID: 27546620
  39. Mutations in TP53 and STK11 also impacted tumor biology regardless of KRAS status, with TP53 strongly associated with enhanced proliferation and STK11 with suppression of immune surveillance. These findings illustrate the remarkably distinct ways through which tumor suppressor mutations may contribute to heterogeneity in KRAS-mutant tumor biology. PMID: 26477306
  40. Studies indicate that the serine-threonine kinase 11 (Peutz-Jeghers syndrome) LKB1 gene is somatically mutated in female reproductive tract cancers. PMID: 27910069
  41. Our results indicate that HPV16 E6/E7 indirectly upregulated the expression of VEGF by inhibition of liver kinase B1 expression and upregulation of hypoxia-inducible factor 2alpha expression,thus propose a human papillomavirus-liver kinase B1-hypoxia-inducible factor 2A-vascular endothelial growth factor axis for the tumorigenesis of lung cancer PMID: 28720067
  42. The expression of LKB1 is down-regulated in most of the lung cell lines. PMID: 28031112
  43. Genetic variability at STK11 locus is associated with coronary artery disease risk in type 2 diabetes in the Chinese population. PMID: 28349069
  44. pregulation of PTEN and LKB1 in concert with negative or low levels of activated Akt, mTOR and S6 indicates that PI3K/Akt/mTOR pathway may not play a significant role in pathogenesis of leiomyoma. PMID: 27748285
  45. Data provide evidence for three novel mutations and three recurrent mutations in STK11 were identified in Chinese families with Peutz-Jeghers syndrome, which further broaden the mutation spectrum of STK11. PMID: 27821076
  46. The mutation detection rate for the LKB1 gene was 85.7% in our Chinese familial Peutz-Jeghers Syndrome and 63.2% in all Chinese Peutz-Jeghers Syndrome patients. The amplification and sequencing results of the flanking sequences presented 3 kinds of polymorphisms in introns of LKB1 gene: (c.374+24G>T, c.464+47_48inGGGGGCC, and c.920+7G>C). PMID: 27721366
  47. STK11 mutation in gastric in gastric-type endocervical adenocarcinoma is associated with worse prognosis. PMID: 27241107
  48. identification of a network linking metabolic and epigenetic alterations that is central to oncogenic transformation downstream of the liver kinase B1 (LKB1, also known as STK11) tumour suppressor, an integrator of nutrient availability, metabolism and growth PMID: 27799657
  49. Severely compromised endogenous LKB1 expression in the L02 cell line may confer to L02 cells tumor-initiating capacities. PMID: 27349837
  50. AMPK exerts multiple actions on TGF-beta signaling and supports that AMPK can serve as a therapeutic drug target for breast cancer PMID: 26718214

Show More

Hide All

Database Links

HGNC: 11389

OMIM: 175200

KEGG: hsa:6794

STRING: 9606.ENSP00000324856

UniGene: Hs.515005

Involvement In Disease
Peutz-Jeghers syndrome (PJS); Testicular germ cell tumor (TGCT)
Protein Families
Protein kinase superfamily, CAMK Ser/Thr protein kinase family, LKB1 subfamily
Subcellular Location
Nucleus. Cytoplasm. Membrane. Mitochondrion.; [Isoform 2]: Nucleus. Cytoplasm. Note=Predominantly nuclear, but translocates to the cytoplasm in response to metformin or peroxynitrite treatment.
Tissue Specificity
Ubiquitously expressed. Strongest expression in testis and fetal liver.

Q&A

What is STK11/LKB1 and why is it important in cancer research?

STK11 (Serine/Threonine Kinase 11), also known as LKB1, is a critical tumor suppressor protein that functions as a serine/threonine kinase. It controls the activity of AMP-activated protein kinase (AMPK) family members, playing vital roles in cell metabolism, polarity, apoptosis, and DNA damage response . STK11 is frequently inactivated in non-small cell lung cancer (NSCLC), particularly in tumors harboring KRAS mutations . Its status has emerged as a biomarker for predicting response to immunotherapies, as STK11-deficient tumors often show resistance to anti-PD-1 therapy .

Which applications are most commonly validated for STK11/LKB1 antibodies?

STK11/LKB1 antibodies have been extensively validated for several research applications:

ApplicationValidation Status
Western Blot (WB)Primary application, validated across multiple cell lines including MCF-7, HepG2, K562, and HEK-293T
Immunohistochemistry (IHC)Validated in human tissues including breast cancer, lung cancer, and testis tissue
Immunoprecipitation (IP)Validated in selected cell lines such as HEK-293
Co-Immunoprecipitation (Co-IP)Validated for protein-protein interaction studies
Immunofluorescence (IF)Validated for cellular localization studies
Knockout/Knockdown ValidationDemonstrated specificity using STK11 knockout cell lines

How should I optimize Western blot protocols for STK11/LKB1 detection?

For optimal Western blot detection of STK11/LKB1:

  • Use reducing conditions and appropriate immunoblot buffer (e.g., Immunoblot Buffer Group 1)

  • Prepare PVDF membranes for optimal protein transfer

  • Apply antibody at recommended dilutions (typically 0.5-2 μg/mL for monoclonal and 1:500-1:10000 for polyclonal antibodies)

  • Expect to detect STK11/LKB1 at approximately 50-55 kDa

  • Include appropriate controls, especially GAPDH as a loading control (critical for quantification)

  • For validation, consider using STK11/LKB1 knockout cell lines (e.g., STK11 knockout HEK293T) as negative controls to confirm antibody specificity

How can I functionally assess STK11 variants identified in clinical samples?

Functional assessment of STK11 variants requires multiple complementary approaches:

  • In vitro kinase assays: Assess autophosphorylation capacity of the STK11 variant using gel-shift assays. Wild-type STK11 typically shows two bands (unmodified and phosphorylated) while loss-of-function variants show only a single unmodified band

  • Luciferase reporter assays: Measure STK11 variant effects on TP53's transcriptional activity using a p53-dependent luciferase reporter system

  • STK11 heterotrimeric complex assessment: Transfect STK11 variants into STK11-deficient cells (e.g., A549), immunoprecipitate the complex, and perform kinase assays followed by Western blot analysis

  • Splice-site variant analysis: For splice-site variants, sequence the tumor mRNA to definitively determine the molecular impact, as DNA sequence alone is insufficient

  • Comparison with in silico prediction algorithms: Evaluate experimental results against computational predictions from multiple algorithms to assess concordance

What considerations are important when using STK11 antibodies for IHC in clinical samples?

For successful IHC applications with STK11 antibodies in clinical tissues:

  • Epitope retrieval optimization: Use heat-induced epitope retrieval with appropriate buffer (recommended: Antigen Retrieval Reagent-Basic or TE buffer pH 9.0; alternative: citrate buffer pH 6.0)

  • Protocol conditions: Incubate primary antibodies at optimal concentrations (1-10 μg/mL for monoclonal; 1:50-1:1200 for polyclonal) overnight at 4°C

  • Detection system selection: For DAB staining, use appropriate HRP-conjugated secondary antibodies and visualization kits

  • Subcellular localization interpretation: STK11/LKB1 can localize to both cytoplasm and nuclei, with specific staining patterns varying by tissue type and disease state

  • Counterstaining: Use hematoxylin (blue) for contrast with the brown DAB staining to clearly visualize cellular structures

  • Controls: Include known positive and negative controls, particularly STK11-deficient tissues or cell lines, to validate staining specificity

What are the experimental challenges in studying the relationship between STK11 mutations and immunotherapy response?

Researchers face several methodological challenges when investigating STK11 mutations and immunotherapy response:

  • Variant classification complexity: Distinguishing between function-altering and benign STK11 variants requires rigorous functional assessment, particularly for missense mutations

  • Tumor microenvironment effects: STK11/LKB1 deficiency promotes neutrophil recruitment with T-cell-suppressive effects, requiring complex immune profiling beyond simple PD-L1 expression analysis

  • Cytokine analysis: STK11/LKB1-deficient tumors show altered cytokine profiles, including increased IL-6, necessitating comprehensive cytokine profiling

  • Confounding genetic alterations: Co-occurring mutations, particularly KRAS mutations, must be accounted for in experimental design

  • Therapeutic response assessment: STK11-mutated tumors show reduced response to PD-1 inhibitors but may respond to alternative approaches like IL-6-neutralizing antibodies or neutrophil-depleting antibodies

How do I validate the specificity of STK11/LKB1 antibodies?

Validate STK11/LKB1 antibody specificity through:

  • Knockout validation: Use STK11/LKB1 knockout cell lines (e.g., LKB1/STK11 knockout HEK293T) as negative controls in Western blots

  • Molecular weight verification: Confirm detection at the expected molecular weight (50-55 kDa for full-length STK11/LKB1)

  • Multiple antibody comparison: Use antibodies targeting different epitopes of STK11/LKB1 to confirm consistent results

  • Phosphatase treatment: For studies investigating phosphorylation, include phosphatase-treated samples to confirm band shifts are due to phosphorylation

  • Recombinant protein controls: Use purified recombinant STK11/LKB1 as a positive control

  • Cross-reactivity assessment: Test the antibody against closely related kinases to ensure specificity

What are best practices for storing and handling STK11/LKB1 antibodies to maintain activity?

To maintain optimal STK11/LKB1 antibody activity:

  • Storage temperature: Store at -20°C to -70°C for long-term storage (stable for one year from receipt)

  • Short-term storage: For reconstituted antibodies, store at 2-8°C under sterile conditions for up to one month

  • Freeze-thaw cycles: Avoid repeated freeze-thaw cycles by aliquoting antibodies before freezing

  • Reconstitution method: Reconstitute lyophilized antibodies at 0.5 mg/mL in sterile PBS

  • Working dilution preparation: Prepare working dilutions fresh on the day of experiment

  • Shipping conditions: Upon receipt of antibodies shipped at ambient temperature (lyophilized) or with polar packs (liquid), immediately store at recommended temperature

What controls are essential when studying STK11/LKB1 function in different experimental systems?

Essential controls for STK11/LKB1 functional studies include:

  • Positive controls: Include cell lines known to express STK11/LKB1 (MCF-7, HepG2, K562)

  • Negative controls: Use STK11/LKB1-deficient cell lines (e.g., A549) or knockout models

  • Loading controls: For Western blots, always include GAPDH or other housekeeping proteins as loading controls

  • Functional validation: For kinase activity studies, include wild-type STK11/LKB1 as a positive control and kinase-dead mutants as negative controls

  • Phosphorylation controls: Use phosphatase treatment to confirm phosphorylation-dependent band shifts

  • Isotype controls: For immunostaining experiments, include appropriate isotype control antibodies

How should I design experiments to investigate STK11's role in cancer immunotherapy resistance?

To investigate STK11's role in immunotherapy resistance:

  • Cell line selection: Use isogenic cell line pairs (STK11 wild-type and STK11-deficient) preferably in KRAS-mutant backgrounds to model clinical scenarios

  • In vivo models: Employ KRAS-driven NSCLC mouse models with and without STK11/LKB1 inactivation

  • Immune profiling: Characterize tumor-infiltrating lymphocytes, neutrophil accumulation, and expression of T-cell exhaustion markers

  • Cytokine analysis: Measure production of tumor-promoting cytokines, particularly IL-6, in the tumor microenvironment

  • Therapeutic interventions: Test PD-1-targeting antibodies, IL-6-neutralizing antibodies, and neutrophil-depleting antibodies to compare response rates

  • PD-L1 expression analysis: Evaluate PD-L1 expression levels as STK11/LKB1-inactivating mutations are associated with reduced PD-L1 expression

What experimental approaches can distinguish between wild-type and functionally impaired STK11 variants?

To distinguish functional from impaired STK11 variants:

  • Gel-shift assays: Detect autophosphorylation capability through the presence of a higher molecular weight phosphorylated band, which is absent in non-functional variants

  • TP53 transcriptional activity: Measure p53-dependent luciferase reporter activity as a readout of STK11 function

  • AMPK phosphorylation assessment: Quantify phosphorylation of AMPK, a direct downstream target of STK11

  • Subcellular localization studies: Examine nuclear versus cytoplasmic distribution of STK11 variants using immunofluorescence

  • Protein stability analysis: Evaluate protein half-life through cycloheximide chase experiments to detect destabilizing variants

  • Heterotrimeric complex formation: Assess the ability of STK11 variants to form functional complexes with STRAD and MO25 through co-immunoprecipitation

Functional StatusGel-Shift Patternp53 Reporter ActivityAMPK Phosphorylation
Wild-typeTwo bands (unmodified + phosphorylated)HighHigh
Loss-of-functionSingle band (unmodified only)LowLow
Partial functionVariable patternIntermediateIntermediate

How can STK11 antibodies be utilized in patient stratification for clinical trials?

STK11 antibodies can contribute to patient stratification in clinical trials through:

  • Tissue analysis: Perform IHC to evaluate STK11/LKB1 protein expression levels and subcellular localization in patient biopsies

  • Correlation with genomic data: Compare IHC results with sequencing data to identify patients with STK11 mutations that result in protein loss versus those with preserved protein despite mutations

  • Functional assessment: Classify patient STK11 variants as functional or non-functional through functional assays to guide enrollment in trials like those investigating TNG260 (CoREST inhibitor) combined with pembrolizumab in STK11-mutated solid tumors

  • Biomarker development: Develop IHC-based screening protocols that can rapidly identify patients with STK11 loss in clinical settings

  • Assay validation: Establish validated cut-off values for STK11 expression levels that correlate with clinical outcomes or drug response

  • Combination biomarkers: Integrate STK11 status with other biomarkers (PD-L1 expression, tumor mutational burden) for more refined patient stratification

How should researchers interpret discrepancies between in silico predictions and experimental results for STK11 variant function?

When facing discrepancies between computational predictions and experimental data:

  • Prioritize experimental evidence: Functional data from kinase assays and reporter systems should take precedence over in silico predictions

  • Consider structural context: Evaluate the variant's location within functional domains or at interaction surfaces that might not be fully captured by prediction algorithms

  • Assess algorithm limitations: Recognize that current prediction algorithms may not adequately account for STK11-specific functional mechanisms

  • Compare multiple algorithms: Evaluate predictions from multiple computational tools (22+ algorithms are available) to identify consensus or outliers

  • Refine model training: Use discrepant cases to improve algorithm training sets, particularly for kinase-specific prediction models

  • Explore novel mechanisms: Consider that variants might affect function through mechanisms not captured by standard assays (e.g., protein-protein interactions, localization)

What methods can correlate STK11 expression patterns with clinical outcomes in cancer studies?

To correlate STK11 expression with clinical outcomes:

Quick Inquiry

Personal Email Detected
Please use an institutional or corporate email address for inquiries. Personal email accounts ( such as Gmail, Yahoo, and Outlook) are not accepted. *
© Copyright 2025 TheBiotek. All Rights Reserved.