STK16 Antibody

What is STK16 and why is it important in cellular research?

STK16 (Serine/Threonine Kinase 16, also known as MPSK, PKL12, and TSF-1) is a myristoylated and palmitoylated serine/threonine protein kinase that is ubiquitously expressed and conserved among eukaryotes . This protein is primarily localized to the Golgi complex throughout the cell cycle and plays critical roles in:

• Regulating actin dynamics to control Golgi structure

• Participating in the TGF-β signaling pathway

• Contributing to TGN protein secretion and sorting mechanisms

• Regulating cell cycle progression and Golgi assembly

As a membrane-associated protein that belongs to the NAK kinase family with an atypical activation loop architecture, STK16 represents an important research target for understanding fundamental cellular processes .

What techniques can STK16 antibodies be reliably used for?

STK16 antibodies have been validated for several experimental applications:

• Immunohistochemistry (IHC): Most commercial antibodies are recommended at dilutions of 1:200-1:500

• Immunofluorescence (IF): Effective at concentrations of 0.25-2 μg/mL

• Co-immunoprecipitation: When using appropriate tags like FLAG in overexpression systems

What is known about STK16 localization and how can this inform antibody-based detection?

STK16 primarily localizes to the Golgi complex throughout the cell cycle . This localization pattern should be considered when:

• Designing immunofluorescence experiments (expect Golgi-like staining patterns)

• Interpreting subcellular fractionation results

• Validating antibody specificity (co-localization with Golgi markers)

• Planning fixation methods (to preserve Golgi structures)

The protein's membrane association through myristoylation and palmitoylation may require specific extraction conditions to effectively solubilize STK16 for certain applications .

How should researchers validate STK16 antibody specificity in their experimental systems?

A multi-step validation approach is recommended:

• RNAi knockdown verification: Compare STK16 signal between control and STK16 siRNA-treated cells. Efficient siRNA sequences documented in literature include GGCCAACAUACUACCCAAAU .

• RNAi-resistant controls: Consider generating cell lines expressing RNAi-resistant STK16 mutants (e.g., with silent mutations at the 894th-914rd region: GGTCAGCACACGACTCAGATA) . This allows distinguishing between specific and off-target effects.

• Tagged protein co-localization: Express tagged versions of STK16 (e.g., STK16-GFP-FLAG) and compare localization with antibody staining .

• Peptide competition assays: Pre-incubate antibodies with immunogen peptides to confirm binding specificity in co-immunoprecipitation experiments .

• Known interaction partners: Verify detection of established interactions such as with MAL2, actin, or WDR1 when using the antibody for interaction studies .

What experimental controls should be included when studying STK16 function using antibody-based approaches?

When designing experiments to study STK16 function:

• Kinase-dead mutants: Include STK16 E202A mutants as controls to distinguish between scaffolding and kinase activity-dependent functions .

• Binding-deficient mutants: F100C mutants can serve as controls for actin binding-dependent functions .

• Subcellular marker controls: Include markers for the Golgi (e.g., GM130) to verify STK16 localization or redistribution under experimental conditions .

• Parallel approaches: Combine antibody detection with kinase inhibition (e.g., using STK16-IN-1) to corroborate findings from genetic manipulation approaches .

• Cell synchronization controls: When studying cell cycle effects, implement proper synchronization controls (e.g., double thymidine block) and time point collections .

How can researchers address data contradictions when STK16 antibody results differ from other detection methods?

When faced with contradictory results:

• Verify reagent quality: Assess antibody batch variation, storage conditions, and potential degradation.

• Compare detection methods: Implement orthogonal approaches such as RT-PCR for mRNA levels versus protein detection .

• Expression system considerations: Recognize that endogenous versus overexpressed STK16 may show different detection patterns or interact differently with binding partners.

• Post-translational modification effects: Consider how myristoylation and palmitoylation might affect epitope accessibility in different experimental conditions .

• Interaction-dependent epitope masking: Determine if protein-protein interactions (e.g., with actin, MAL2) might be masking antibody epitopes in certain cellular contexts .

What are the recommended protocols for detecting STK16 interactions with other proteins?

To effectively study STK16 protein interactions:

• Co-immunoprecipitation protocol:

  • Culture cells to 95-100% confluence and lyse in appropriate buffer

  • Centrifuge lysates at 13,000g for 10 minutes at 4°C

  • Incubate supernatants with antibody-conjugated beads (e.g., anti-FLAG or anti-STK16) for 2 hours at 4°C

  • Wash with ice-cold PBS containing 0.05% Tween-20 three times (5 minutes each)

  • Elute and analyze by western blotting

• Yeast two-hybrid screening:

  • Validate Y2H hits with co-immunoprecipitation

  • Include peptide competition controls to confirm specificity

  • Quantify interaction (typically 0.8-1.7% of total STK16 co-precipitates with partners like MAL2)

• Interaction visualization:

  • Use immunofluorescence to examine co-localization

  • Implement proximity ligation assays for detecting in situ interactions

  • Consider FRET-based approaches for direct interaction studies

What strategies can overcome limitations in detecting endogenous STK16?

When facing challenges detecting endogenous STK16:

• Alternative detection methods:

  • RT-PCR using validated primers when antibodies perform poorly in western blot or immunofluorescence

  • Quantitative PCR to measure expression levels

  • Mass spectrometry-based approaches for protein identification

• Signal enhancement strategies:

  • Tyramide signal amplification for immunohistochemistry

  • Concentration of target protein through subcellular fractionation

  • Use of high-sensitivity detection substrates or imaging systems

• Generation of stable cell models:

  • Develop cell lines with tagged endogenous STK16 using CRISPR/Cas9 knock-in approaches

  • Create inducible expression systems for controlled STK16 expression levels

How can researchers effectively study STK16's role in actin dynamics and Golgi organization?

To investigate STK16's function in actin regulation and Golgi organization:

• Actin binding studies:

  • Perform in vitro actin binding assays with purified components

  • Use live-cell imaging with fluorescently labeled actin to track dynamics

  • Implement STK16 knockdown or inhibition followed by phalloidin staining to visualize F-actin structures

• Golgi organization assessment:

  • Quantify Golgi fragmentation following STK16 knockdown or inhibition

  • Use super-resolution microscopy to examine detailed Golgi morphology

  • Implement live-cell imaging during cell cycle progression to track Golgi dynamics

• Functional reconstitution:

  • Rescue experiments with wild-type versus mutant STK16

  • Structure-function analysis using point mutations in key domains

  • Kinase activity assays to correlate enzymatic activity with cellular phenotypes

What experimental design considerations are important when studying STK16 during cell cycle progression?

For cell cycle-related STK16 studies:

• Synchronization protocols:

  • Double thymidine block method: Treat cells with 2.5 mM thymidine for 16 hours, release for 8 hours, then re-treat for 16 hours to synchronize at G1/S transition

  • Collect samples at defined intervals after release to capture different cell cycle stages

• Combined approaches:

  • When performing STK16 knockdown with cell synchronization, transfect siRNA in suspension cells prior to seeding, followed by a second transfection after washing off the first thymidine treatment

  • When using STK16 inhibitors with synchronization, add inhibitors 4 hours after the second thymidine release

• Analytical methods:

  • Flow cytometry to quantify cell cycle distribution

  • Time-lapse microscopy to track individual cells through division

  • Immunofluorescence at fixed timepoints to examine STK16 localization relative to cell cycle markers

How can STK16 antibodies be used to investigate its role in TGF-β signaling pathways?

STK16 has been implicated in TGF-β signaling, and researchers can investigate this relationship by:

• Examining phosphorylation status of downstream TGF-β effectors following STK16 manipulation

• Analyzing nuclear translocation of SMAD proteins in response to STK16 activity

• Employing chromatin immunoprecipitation to assess STK16's impact on transcription factor binding at TGF-β responsive elements

• Using reporter assays with TGF-β responsive promoters to quantify signaling activity

The interaction between STK16 and the TGF-β pathway represents an important area for future research, potentially linking Golgi function to growth factor signaling.

What approaches can help distinguish between STK16's structural and kinase-dependent functions?

To differentiate between STK16's scaffolding and enzymatic roles:

• Comparative analysis using kinase-dead mutants:

  • Express E202A mutants alongside wild-type STK16

  • Analyze phenotypic differences between kinase inhibition and protein depletion

  • Perform phosphoproteomics to identify substrates affected by kinase activity versus protein presence

• Domain-specific disruption:

  • Target specific protein-protein interaction domains while preserving kinase function

  • Employ FRET-based kinase activity sensors in cells expressing different STK16 variants

  • Use chemical genetics approaches with analog-sensitive STK16 mutants