TAF1C Antibody

What is TAF1C and what is its biological function?

TAF1C (TATA box binding protein-associated factor, RNA polymerase I, C) is a critical component of the transcription factor SL1/TIF-IB complex involved in RNA polymerase I-dependent transcription. The protein plays an essential role in the assembly of the pre-initiation complex (PIC) during rRNA gene transcription .

TAF1C functions to:

• Recruit RNA polymerase I to the rRNA gene promoter through interaction with RRN3

• Stabilize nucleolar transcription factor 1/UBTF on rDNA

• Facilitate the formation of SL1/TIF-IB, which excludes the association of TBP with TFIID subunits

• Directly bind to the rDNA promoter to promote SL1 recruitment

The calculated molecular weight of TAF1C is 95 kDa, which corresponds to the observed molecular weight in Western blot experiments .

What validated applications exist for TAF1C antibodies?

TAF1C antibodies have been validated for multiple research applications with specific recommended parameters:

What is the optimal protocol for Western blot detection of TAF1C?

Recommended Western Blot Protocol for TAF1C:

• Sample Preparation:

  • Collect cells and lyse using 1× SDS buffer supplemented with protease inhibitors (PMSF) and phosphatase inhibitors

  • Boil lysates for 10 minutes and centrifuge at 16,000 g for 10 minutes at 4°C to remove cellular debris

• Protein Separation and Transfer:

  • Separate proteins using standard SDS-PAGE

  • Transfer to PVDF membranes

• Blocking and Antibody Incubation:

  • Block with 0.1% casein at room temperature for 1 hour

  • Incubate with primary TAF1C antibody (1:500-1:1000 dilution) overnight at 4°C

  • Incubate with HRP-conjugated secondary antibodies for 1 hour at room temperature

• Detection:

  • Visualize using chemiluminescent detection systems

  • Expected band size: 95 kDa

How should immunofluorescent staining be optimized for TAF1C detection?

Optimized Immunofluorescence Protocol:

• Sample Preparation:

  • Fix cells in 4% paraformaldehyde

  • Permeabilize with 0.5% PBS-Triton X-100 for 10 minutes

• Blocking and Antibody Incubation:

  • Block with 5% goat serum for 1 hour

  • Incubate with TAF1C antibody overnight at 4°C

  • Incubate with appropriate secondary antibody (488 or 594 conjugated anti-rabbit/mouse IgG)

• Mounting and Imaging:

  • Mount in anti-fade reagent with DAPI for nuclear counterstaining

  • Analyze using fluorescence microscopy

What controls should be included when using TAF1C antibodies?

For rigorous experimental design, include:

• Positive Controls:

  • Known TAF1C-expressing cell lines (HT-1080, HeLa, Jurkat, 293T)

  • Human liver cancer tissue for IHC applications

• Negative Controls:

  • TAF1C knockdown samples using validated shRNAs (e.g., target sequence "GCAGGTGAGCTTCATTTGATT")

  • Isotype-matched control antibodies

• Loading Controls:

  • Standard housekeeping proteins for Western blot normalization

  • Nuclear markers when examining nuclear/nucleolar localization

How can TAF1C knockdown be implemented to study its function?

TAF1C Knockdown Strategy:

• shRNA Design:

  • Validated target sequence: "GCAGGTGAGCTTCATTTGATT"

  • Clone into lentiviral vectors such as pLKO.1

• Delivery Method:

  • Lentiviral transduction for stable expression

  • Validate knockdown efficiency by Western blot

• Functional Assays:

  • Colony formation assay (500 cells per well in 6-well plates, cultured for 14 days)

  • Crystal violet staining for colony visualization

  • Quantification using ImageJ software

• Molecular Impact Assessment:

  • rRNA transcription (EU nascent RNA detection)

  • Nucleolar stress markers (Fibrillarin, Nucleophosmin)

  • c-MYC stability analysis

How can TAF1C's role in ribosome biogenesis be evaluated?

Methods to Study TAF1C in Ribosome Biogenesis:

What protein interactions should be investigated when studying TAF1C function?

TAF1C functions within a complex network of proteins involved in rRNA transcription. Key interactions to investigate include:

What is the relationship between TAF1C expression and cancer progression?

TAF1C expression has significant implications in cancer biology:

• Prognostic Value:

  • Overexpression correlates with poor prognosis in stomach adenocarcinoma (STAD)

  • High expression associated with poor outcomes in hepatocellular carcinoma (HCC)

• Functional Impact:

  • TAF1C knockdown inhibits STAD cell proliferation and survival both in vitro and in vivo

  • Depletion impairs rRNA gene transcription and processing

  • Knockdown induces nucleolar stress and promotes c-MYC degradation

• Mechanistic Insights:

  • TAF1C likely contributes to cancer progression by enhancing ribosome biogenesis

  • May represent a vulnerability in cancers dependent on elevated protein synthesis

How do monoclonal and polyclonal TAF1C antibodies compare in cancer research applications?

Comparative Analysis of TAF1C Antibody Types:

Selection should be based on the specific experimental requirements and research objectives.

What are common issues with TAF1C antibody performance in immunohistochemistry?

IHC Troubleshooting Guide:

• Poor or Variable Staining:

  • Optimize antigen retrieval method (recommended: TE buffer pH 9.0 or citrate buffer pH 6.0)

  • Adjust antibody dilution (start with 1:50-1:500 range)

  • Increase incubation time or temperature

• High Background:

  • Optimize blocking conditions

  • Use fresh reagents

  • Reduce antibody concentration

  • Include additional washing steps

• Inconsistent Results:

  • Standardize fixation protocols

  • Control tissue section thickness

  • Validate on known positive controls (e.g., human liver cancer tissue)

How can specificity of TAF1C antibody signals be verified?

Validation Strategies:

• Molecular Weight Verification:

  • Confirm detection at expected molecular weight (~95 kDa)

  • Check for presence/absence of non-specific bands

• Knockdown Controls:

  • Compare staining between control and TAF1C-depleted samples

  • Use validated shRNA sequences (e.g., "GCAGGTGAGCTTCATTTGATT")

• Multiple Antibody Approach:

  • Test independent antibodies recognizing different epitopes

  • Cross-validate findings using antibodies from different vendors

• Subcellular Localization:

  • Verify nuclear/nucleolar localization consistent with TAF1C function

  • Co-stain with nucleolar markers (e.g., Fibrillarin, Nucleophosmin)

What emerging applications might benefit from TAF1C antibody development?

• Chromatin Immunoprecipitation Sequencing (ChIP-seq):

  • Mapping TAF1C binding sites across the genome

  • Understanding regulatory mechanisms of rRNA gene selection

• Single-Cell Analyses:

  • Developing TAF1C antibodies compatible with mass cytometry

  • Investigating cell-to-cell variability in ribosome biogenesis regulation

• Multiplex Imaging:

  • Creating TAF1C antibodies for multiplexed immunofluorescence

  • Studying spatial relationships with other nucleolar components

• Therapeutic Monitoring:

  • Developing companion diagnostics for potential ribosome biogenesis inhibitors

  • Monitoring TAF1C expression in response to cancer treatments

How might TAF1C antibodies contribute to understanding ribosome biogenesis disorders?

• Congenital Disorders:

  • Investigating TAF1C mutations associated with congenital pouch colon type IV

  • Studying ribosome biogenesis defects in ribosomopathies

• Cancer Biomarkers:

  • Developing TAF1C antibody-based diagnostic tools

  • Stratifying patients based on ribosome biogenesis dependency

• Therapeutic Targeting:

  • Identifying patient populations most likely to respond to ribosome biogenesis inhibitors

  • Monitoring treatment efficacy through TAF1C expression/localization changes

Colony Formation Assay Protocol for TAF1C Functional Studies

• Digest cells in logarithmic growth phase with 0.25% Trypsin-EDTA

• Seed 500 cells per well in 6-well plates

• Culture for 14 days, changing medium every 3 days

• Stain colonies with crystal violet solution for 15 minutes

• Wash with water to reduce background

• Capture images and quantify using ImageJ software

EU Nascent RNA Detection Protocol

• Add EU to complete culture medium from 100 mM stock in DMSO

• Culture cells with EU for 6 hours

• Fix cells in 4% paraformaldehyde for 20 minutes

• Permeabilize with 0.5% PBS-Triton X-100 for 10 minutes

• Stain for 30 minutes at room temperature with click chemistry reagents

• Wash with TBST and mount with DAPI for imaging