TEN1 Human

What is human TEN1 and what is its primary function in telomere biology?

Human TEN1 is a component of the mammalian CTC1-STN1-TEN1 (CST) complex that plays crucial roles in telomere maintenance and genome-wide replication. The protein consists of a single OB (oligonucleotide/oligosaccharide binding) fold domain that facilitates DNA binding . TEN1 functions in telomere duplex replication, C-strand fill-in following telomerase action, and assists in replication restart after fork stalling throughout the genome . While TEN1 works in conjunction with CTC1 and STN1 in most contexts, research suggests it may have additional functions beyond those of the other CST components . The importance of TEN1 is highlighted by the fact that its depletion causes phenotypes similar to CTC1 or STN1 depletion, but often with increased severity, particularly in telomere loss and anaphase bridge formation .

How does the structure of human TEN1 compare to its homologs in other species?

The high-resolution structure of the human Stn1-Ten1 complex reveals that human TEN1 consists of a single OB fold domain. This structure is strikingly similar to both replication protein A (RPA) and the yeast Stn1-Ten1 complex, indicating structural conservation across species despite evolutionary divergence . The contacts between the OB domains of hStn1 and hTen1 facilitate complex formation. While structural conservation exists between human and yeast TEN1, there may be functional differences in how the protein operates within the respective CST complexes. The conservation of structure suggests fundamental importance of the TEN1 protein architecture in maintaining its critical cellular functions .

What are the most effective methods for TEN1 depletion in human cell lines?

Based on published protocols, effective TEN1 depletion can be achieved through lentivirus-mediated shRNA knockdown. Specifically, researchers have successfully used multiple shRNA constructs targeting different regions of TEN1:

• shTEN1#1 (Sigma TRCN0000337412, Puro^R)

• shTEN1#2 (Open Biosystems V3LHS_389003, GFP)

• shTEN1#3 (Sigma TRCN0000337413, Puro^R)

For optimal depletion, a sequential approach may be used: first infecting cells with one shRNA construct followed by selection (puromycin or FACS sorting for GFP), then introducing a second shRNA targeting a different region of TEN1. This approach has yielded stable cell lines with significant TEN1 depletion . The efficiency of knockdown should be verified through RT-qPCR using primers designed to avoid amplification of TEN1 pseudogenes (recommended primers: 5′-GGCCAAGTTCCTGATGGG and 5′-CAGTGTTACTCTGGACTGAATCAT) or through Western blotting with antibodies raised against purified 6HIS-TEN1 protein .

How can researchers effectively generate and validate TEN1 rescue cell lines?

Creating rescue cell lines is crucial for confirming phenotype specificity in TEN1 depletion studies. The recommended approach includes:

• Generate a TEN1 expression construct containing silent mutations in the shRNA target sites to prevent degradation of the rescue transcript

• Example of effective silent mutations: TGTCTGTACGATATGATACAGTCGAGGGTTACTCTCATGGCA (mutations underlined)

• Clone the mutant allele into a retroviral vector (e.g., pMSCV-IThy1-1)

• Infect the stable TEN1-depleted cell line with the rescue construct virus

• Select transduced cells by sorting for the marker (e.g., Thy1-1)

• Isolate clonal populations and validate rescue expression by RT-qPCR and Western blotting

• Confirm functional rescue by assessing reversal of TEN1 depletion phenotypes

This methodology has been successfully employed to demonstrate specific effects of TEN1 depletion and distinguish them from potential off-target effects.

How does TEN1 contribute to G-overhang processing and C-strand synthesis?

TEN1 plays a critical role in G-overhang processing, particularly during late S/G2 phase of the cell cycle. Research indicates that:

Specifically, while CTC1-STN1 can limit telomerase action to prevent G-overhang overextension, TEN1 is essential for the subsequent C-strand synthesis. Cells lacking TEN1 exhibit progressive telomere shortening, highlighting its crucial role in telomere length maintenance . The evidence suggests that TEN1 enhances the stability of CST binding to DNA, which is necessary for properly engaging DNA polymerase α on the overhang for C-strand synthesis .

What phenotypes result from TEN1 depletion at telomeres compared to CTC1 or STN1 depletion?

TEN1 depletion results in several telomere-related phenotypes, some of which are distinct from or more severe than those observed with CTC1 or STN1 depletion:

These differential phenotypes suggest that while TEN1 functions alongside CTC1 and STN1 in most contexts, it likely has additional roles that are not shared with the other CST components .

How does TEN1 contribute to genome stability beyond telomeres?

TEN1 plays important roles in genome-wide replication and stability beyond its telomeric functions:

• Like CTC1 and STN1, TEN1 depletion causes a decrease in genome-wide replication restart following fork stalling

• This suggests TEN1/CST serves as a specialized replication factor that helps resolve replication challenges throughout the genome

• TEN1 depletion leads to more severe anaphase bridge formation than observed with CTC1 or STN1 depletion, indicating a potentially unique role in preventing genomic instability

• The CST complex may function as a DNA polymerase α accessory factor (AAF) that stimulates template binding and enzyme processivity

These findings indicate that TEN1/CST helps solve a diverse array of replication problems beyond telomeres. The enhanced severity of genomic instability phenotypes upon TEN1 depletion suggests it may have functions independent of the complete CST complex, possibly in conjunction with other replication factors .

What is the molecular basis for TEN1's DNA binding properties and how do they impact its function?

DNA binding analysis reveals important insights into TEN1's molecular function:

The structural data indicates that contacts between the OB domains of hStn1 and hTen1 facilitate formation of a complex similar to replication protein A (RPA). This structural arrangement likely underlies the DNA binding properties of the CST complex that are essential for its function in telomere maintenance and replication .

Are there disease associations with TEN1 mutations or dysfunction?

Unlike CTC1 and STN1, there are currently no documented disease-linked mutations or single-nucleotide polymorphisms in human TEN1. In contrast:

• Mutations in CTC1 underlie several diseases including dyskeratosis congenita and Coats plus

• Single-nucleotide polymorphisms associated with human STN1 (OBFC1) correlate with the presence of short telomeres

• The absence of reported TEN1-associated diseases may be due to:

  • Essential nature of TEN1 function making mutations incompatible with viability

  • Redundancy in some TEN1 functions

  • Limited investigation specifically targeting TEN1 variants in disease populations

How do non-synonymous SNPs impact TEN1 structure and function?

Research into non-synonymous SNPs in TEN1 has revealed potential impacts on protein structure and function:

• TEN1 is a key component of the CST complex implicated in maintaining telomere homeostasis and providing stability to the eukaryotic genome

• Non-synonymous SNPs (nsSNPs) can alter amino acid sequences, potentially affecting protein folding, stability, and functional interactions

• Computational and structural analysis of nsSNPs in TEN1 can identify variants likely to impact the protein's ability to form the CST complex or bind DNA

• Predicted deleterious nsSNPs may affect the OB fold domain structure, disrupting either protein-protein interactions with STN1 or DNA binding capabilities

What cell line models are most appropriate for studying TEN1 function?

Different cell lines exhibit varying responses to TEN1 depletion, suggesting cell-type specific aspects of TEN1 function:

When designing experiments to study TEN1:

• Consider using multiple cell lines to identify cell-type specific effects

• Include appropriate controls (non-targeting shRNA, rescue cell lines)

• Verify knockdown efficiency by both RT-qPCR and Western blotting

• For long-term studies, consider generating conditional knockout systems rather than relying solely on stable knockdowns

• Include parallel experiments with CTC1 and STN1 depletion for comparative analysis

What assays best measure TEN1's impact on telomere maintenance?

Based on published research, several complementary assays effectively assess TEN1's role in telomere maintenance:

For comprehensive analysis, researchers should employ multiple assays to capture different aspects of TEN1 function in telomere maintenance and replication.

What are the most promising approaches for identifying additional TEN1 binding partners?

To identify novel TEN1 binding partners beyond the known CST complex members:

• Proximity-based Labeling:

  • BioID or TurboID fusion proteins can identify proteins in close proximity to TEN1 in living cells

  • Provides physiologically relevant interaction data

  • Can detect transient or context-dependent interactions

• Immunoprecipitation-Mass Spectrometry:

  • Using epitope-tagged TEN1 expressed at near-endogenous levels

  • Crosslinking can capture transient interactions

  • Compare interactomes with and without replication stress or in different cell cycle phases

• Yeast Two-Hybrid Screening:

  • Can identify direct binding partners

  • Use TEN1 or specific TEN1 domains as bait

  • Validate interactions in mammalian cells

• Genetic Interaction Screens:

  • CRISPR-based screens to identify genes that show synthetic lethality with TEN1 depletion

  • Can reveal functional relationships even without direct physical interaction

These approaches may uncover additional roles for TEN1 beyond the CST complex and explain the more severe phenotypes observed with TEN1 depletion compared to CTC1 or STN1 depletion .

How might targeting TEN1 function be exploited in cancer research?

TEN1's critical role in telomere maintenance and replication stress response suggests several potential applications in cancer research:

• Synthetic Lethality Approaches:

  • Cancer cells often experience higher levels of replication stress

  • TEN1 inhibition may selectively affect cancer cells that rely on efficient replication stress resolution

  • Particularly promising for cancers with existing DNA repair deficiencies

• Telomerase-Positive Cancer Targeting:

  • Since the CST complex regulates telomerase activity at telomeres

  • Disrupting TEN1 function might enhance telomere dysfunction in telomerase-positive cancers

  • Could potentially synergize with telomerase inhibitors

• Combination Therapy Strategies:

  • TEN1 inhibition could sensitize cells to:

    • Replication inhibitors (gemcitabine, hydroxyurea)

    • PARP inhibitors

    • ATR inhibitors

    • G-quadruplex stabilizers that affect telomere replication

• Biomarker Development:

  • TEN1 expression or localization might serve as a biomarker for genomic instability

  • Could potentially indicate sensitivity to certain therapeutic approaches

These applications require further research into TEN1's specific functions and the development of tools to selectively modulate its activity in cellular contexts relevant to cancer research.