TFF3 Human, His

Trefoil Factor-3 Human Recombinant, His Tag
Shipped with Ice Packs
In Stock
Cat. No.
BT23351
Source
Escherichia Coli.
Synonyms
TFF-3, ITF, TFI, HITF, hP1.B, TFF3, Trefoil factor 3, Intestinal trefoil factor.
Appearance
White lyophilized (freeze-dried) powder.
Purity
Greater than 95.0% as by SDS-PAGE.
Usage
THE BioTek's products are furnished for LABORATORY RESEARCH USE ONLY. The product may not be used as drugs, agricultural or pesticidal products, food additives or household chemicals.
Quick Inquiry

Description

Molecular Structure and Biochemical Properties

TFF3 Human, His consists of 69 amino acids (residues 22–80 of native TFF3) with an N-terminal His-tag (MKHHHHHHAS) . Key structural features include:

  • Trefoil domain: Residues 10–50 form three intrachain disulfide bonds (Cys I–V, Cys II–IV, Cys III–VI), creating a compact, metabolically stable three-loop structure .

  • Dimerization capacity: A free C-terminal cysteine (Cys VII) enables covalent homodimer formation, enhancing bioactivity in mucosal repair and cancer progression .

ParameterSpecification
Molecular weight7.82 kDa (monomer)
Purity>95% (SDS-PAGE)
Expression systemEscherichia coli
StorageLyophilized at -18°C; reconstituted at 0.5 mg/mL in 20 mM Tris, 150 mM NaCl (pH 7.5)

Functional Roles and Mechanisms

TFF3 Human, His retains the biological activities of native TFF3:

Mucosal Protection and Repair

  • Promotes epithelial cell migration via EGFR/MAPK signaling .

  • Stabilizes mucus layers in respiratory and gastrointestinal tracts by binding FCGBP and MUC2/MUC5AC .

Cancer Pathogenesis

  • Prostate cancer: Silencing TFF3 reduces tumor growth by inducing mitochondrial apoptosis (↑BAX/BCL2 ratio, cytochrome C release) .

  • Hepatocellular carcinoma (HCC): Overexpression correlates with promoter hypomethylation and advanced tumor grade .

  • Gastric cancer: High TFF3 expression predicts lymph node metastasis and poor survival (HR = 2.52 × 10⁻²⁴) .

Synthesis and Purification

  • Expressed in E. coli and purified via IMAC .

  • Homodimers are isolated using size-exclusion chromatography .

Stability Profile

ConditionStability
Lyophilized stateStable for 3 weeks at 25°C
Reconstituted solution2–7 days at 4°C; long-term storage at -18°C with 0.1% HSA/BSA
Gastrointestinal enzymesGenerates gut-stable metabolite TFF3₇₋₅₄ (t₁/₂ >24 hr)

Key Experimental Findings

  1. Apoptosis assays: TFF3 silencing in PC-3 prostate cancer cells elevated caspase-3/9 cleavage by 4.5-fold .

  2. In vivo models: TFF3 homodimer reduced colitis severity by 60% compared to monomers .

  3. Diagnostic utility: TFF3 overexpression in HCC tissues (40% of cases) serves as a methylation-driven biomarker .

Primers for TFF3 Analysis

PrimerSequence (5′→3′)Application
hTFF3FCTCCAGCTCTGCTGAGGAGTqPCR (human)
hTFF3RCAGGGATCCTGGAGTCAAAGqPCR (human)
mTff3FTAATGCTGTTGGTGGTCCTGqPCR (mouse)
mTff3RCAGCCACGGTTGTTACACTGqPCR (mouse)

Source:

Limitations and Future Directions

  • Receptor ambiguity: Putative receptors CXCR4 and LINGO2 show no binding affinity up to 10 μM .

  • Therapeutic challenges: Rapid gastrointestinal degradation necessitates metabolite TFF3₇₋₅₄ for oral delivery .

Product Specs

Introduction
The TFF family of proteins is characterized by the presence of at least one trefoil motif, a 40-amino acid domain containing 3 conserved disulfide bonds. These proteins are stable, secreted molecules found in the gastrointestinal mucosa, where they play roles in mucosal protection, mucus layer stabilization, and epithelial healing. TFF2, for instance, regulates gastric acid secretion and motility, and stabilizes mucus glycoproteins. TFF3, on the other hand, promotes airway epithelial cell differentiation and ciliogenesis, potentially via an EGFR-dependent pathway. Interestingly, TFF3 overexpression has been linked to the progression of hepatocellular carcinoma in both mice and humans, and its expression levels correlate with tumor grade.
Description
Recombinant human TFF3, expressed in E. coli, is a non-glycosylated polypeptide chain containing 69 amino acids (residues 22-80). It includes a 10-amino acid His tag fused at the N-terminus, resulting in a total molecular mass of 7.82 kDa. The protein is purified using proprietary chromatographic techniques.
Physical Appearance
A white powder in lyophilized form.
Formulation
The TFF3 protein was lyophilized from a 0.4 µm filtered solution with a concentration of 0.5 mg/mL in a buffer containing 20 mM Tris pH 7.5 and 150 mM NaCl.
Solubility
To prepare a working solution, add deionized water to achieve a concentration of approximately 0.5 mg/mL, ensuring complete dissolution of the lyophilized pellet. This product is not sterile. Prior to use in cell culture, ensure sterility by filtering the solution through an appropriate sterile filter.
Stability
Lyophilized TFF3 remains stable at room temperature for up to 3 weeks. However, for long-term storage, it is recommended to store the desiccated protein below -18°C. Once reconstituted, TFF3 should be stored at 4°C for a period of 2-7 days. For extended storage, it is advisable to add a carrier protein such as HSA or BSA (0.1%). Avoid repeated freeze-thaw cycles.
Purity
The purity of this product is determined to be greater than 95.0% as assessed by SDS-PAGE.
Synonyms
TFF-3, ITF, TFI, HITF, hP1.B, TFF3, Trefoil factor 3, Intestinal trefoil factor.
Source
Escherichia Coli.
Amino Acid Sequence
MKHHHHHHAS EEYVGLSANQ CAVPAKDRVD CGYPHVTPKE CNNRGCCFDS RIPGVPWCFK PLQEAECTF.

Product Science Overview

Introduction

Trefoil Factor-3 (TFF3), also known as Intestinal Trefoil Factor (ITF), is a member of the trefoil factor family of peptides. These peptides are characterized by the presence of one or more trefoil domains, which are compact, stable structures containing three conserved disulfide bonds. TFF3 plays a crucial role in the maintenance and repair of the intestinal mucosa, promoting the mobility of epithelial cells during healing processes.

Structure and Expression

The human recombinant TFF3 protein with a His tag is a full-length protein expressed in HEK 293 cells. It consists of 94 amino acids and includes a His tag at the C-terminus for purification purposes . The His tag facilitates the purification of the protein using immobilized metal affinity chromatography (IMAC), ensuring high purity and yield.

Biological Function

TFF3 is primarily involved in the protection and repair of the gastrointestinal tract. It promotes epithelial restitution, a process where epithelial cells migrate to cover denuded areas of the mucosa, thus playing a critical role in mucosal healing. TFF3 also exhibits anti-apoptotic properties, helping to maintain the integrity of the epithelial barrier under stress conditions .

Applications

Recombinant TFF3 protein is widely used in research to study its role in gastrointestinal diseases, including inflammatory bowel disease (IBD) and colorectal cancer. It is also utilized in high-throughput screening assays to identify potential therapeutic agents that can modulate its activity .

Production and Purification

The recombinant TFF3 protein is produced in HEK 293 cells, which are human embryonic kidney cells commonly used for protein expression due to their high transfection efficiency and ability to perform post-translational modifications. The protein is purified to a high degree of purity (>95%) and has an endotoxin level of less than 1 EU/µg, making it suitable for various biochemical assays .

Storage and Stability

The lyophilized recombinant TFF3 protein is stable at 2-8°C but should be stored at -20°C for long-term storage. Upon reconstitution, it is recommended to store the protein in working aliquots at -20°C to -80°C to avoid repeated freeze-thaw cycles, which can affect its stability and activity .

Quick Inquiry

Personal Email Detected
Please use an institutional or corporate email address for inquiries. Personal email accounts ( such as Gmail, Yahoo, and Outlook) are not accepted. *

Category

Service

Related Products

TFF1 Human
Trefoil Factor-1 Human Recombinant
Cat. No.
BT22925
Source
Escherichia Coli.
TFF1 Human, His
Trefoil Factor-1 Human Recombinant, His Tag
Cat. No.
BT23026
Source
Escherichia Coli.
TFF3 Human
Trefoil Factor-3 Human Recombinant
Cat. No.
BT23285
Source
Escherichia Coli.
TFF3 Rat
Trefoil Factor-3 Rat Recombinant
Cat. No.
BT23427
Source
Escherichia Coli.
THE BIOTEK
THE BioTek is a global biotech company offering highly purified proteins for research in cancer, apoptosis, development, endocrinology, immunology, neuroscience, proteases, and stem cells.
  • Contact
  • Address: 1925 E Maple Ave, El Segundo, CA 90245 United States
  • Phone : +1 201-285-7826
  • Email : info@thebiotek.com
  • Hours : Mon.-Fri. 9:00 AM - 5:00 PM
© Copyright 2025 TheBiotek. All Rights Reserved.