tmem17a Antibody

Introduction to TMEM176A Antibody

TMEM176A (Transmembrane Protein 176A) is a member of the MS4A protein family, implicated in immune regulation and cancer progression. Antibodies targeting TMEM176A are critical tools for studying its expression, intracellular localization, and functional roles. These antibodies have been utilized to investigate TMEM176A's association with lymphoma, lung cancer, and immune cell signaling pathways .

Development and Validation of TMEM176A Antibodies

Custom polyclonal antibodies against human TMEM176A have been developed for research applications:

• Production: Rabbit polyclonal antibodies (pAbs) were generated using peptide sequences from TMEM176A's large extracellular loop. Affinity purification and validation via Western blot confirmed specificity .

• Epitope Mapping: The antibodies target distinct regions of TMEM176A, as shown by sequence alignment and cross-reactivity assays (Figure 2b in ).

• Applications:

  • Immunofluorescence (IF): Detected TMEM176A in formalin-fixed paraffin-embedded (FFPE) cancer tissues .

  • Western Blot: Validated in heterologous expression systems (e.g., HeLa cells) .

Role of TMEM176A in Cancer Pathology

TMEM176A is overexpressed in multiple cancers, with implications for tumor growth and immune evasion:

• Mechanisms:

  • TMEM176A interacts with TMEM176B, forming complexes that may regulate ion channel activity .

  • Silencing TMEM176A in NSCLC cells (A549, 95D) increases apoptosis (Annexin V+/7-AAD+ cells) and reduces S-phase progression .

TMEM176A in Immune Regulation

• Th17 Cells: TMEM176A is highly expressed in RORγt+ Th17 cells and intestinal Tconv cells, suggesting a role in type 17 immunity .

• Inflammasome Modulation: TMEM176B (a homolog) inhibits caspase-1/IL-1β signaling, impacting antitumor CD8+ T cell responses . While TMEM176A’s direct role here is unclear, redundancy with TMEM176B is likely .

Signaling Pathways

• AKT/mTOR: TMEM176B regulates AKT/mTOR in cancer cells, influencing proliferation and migration . Similar pathways may apply to TMEM176A .

Key Techniques and Reagents

• Primers for TMEM176A Detection:

  Application	Forward Primer (5’→3’)	Reverse Primer (5’→3’)
  Standard PCR	ATGGGAACAGCCGACAGTGAT	CTAGATTCCACTCACTTCCAA
  Real-time qPCR	CATGGACATGCTGAAGGCCTTGTT	ACATTCTCCAGCAGTACAGCCACA

• Tissue Microarray (TMA) Analysis:

  • Fluorometric detection using IRDye 800CW-conjugated anti-TMEM176A pAbs (1 mg/mL) revealed elevated expression in lymphoma biopsies .

Current Challenges and Future Directions

• Localization Conflicts: TMEM176A’s subcellular localization varies across cell types, with reports of Golgi apparatus association versus endosomal membrane presence .

• Therapeutic Potential: Dual targeting of TMEM176A/B may enhance antitumor immunity, necessitating conditional knockout models .

• Biomarker Development: Further studies are needed to validate TMEM176A as a diagnostic or prognostic marker in liquid biopsies .