TM6SF2 Antibody, Biotin conjugated

What is TM6SF2 and what is its biological significance?

TM6SF2 (Transmembrane 6 Superfamily Member 2) is a protein primarily expressed in the liver and intestine, playing a crucial role in lipid metabolism regulation. It functions as a protective factor in high-fat diet conditions, where its deficiency enhances hepatic lipid accumulation through dysregulated fatty acid metabolism . Research has demonstrated that TM6SF2 is localized to the endoplasmic reticulum (ER) and ER-Golgi intermediate compartment (ERGIC), cellular structures with major functions in hepatic triglyceride secretion .

The protein has gained significant attention in metabolic research due to its involvement in triglyceride secretion from hepatocytes. Genetic variations in TM6SF2, particularly the E167K polymorphism, have been strongly associated with non-alcoholic fatty liver disease (NAFLD) and cardiovascular conditions, highlighting its central role in metabolic health .

What are the validated applications for TM6SF2 Antibody, Biotin conjugated?

Based on comprehensive validation studies, TM6SF2 Antibody, Biotin conjugated is suitable for multiple research applications:

The biotin conjugation provides enhanced sensitivity and versatility through avidin/streptavidin detection systems, making this antibody particularly valuable for applications requiring signal amplification .

What is the species reactivity profile of TM6SF2 Antibody?

TM6SF2 Antibody has been validated for reactivity with human, mouse, and rat TM6SF2 proteins . This cross-species reactivity makes the antibody valuable for comparative studies across different mammalian models. Western blot analyses demonstrated specific detection of the expected 48/50 kDa native TM6SF2 protein in mouse liver samples, while additional experiments confirmed reactivity with recombinant human and mouse TM6SF2 proteins . This multi-species reactivity is particularly beneficial for translational research comparing TM6SF2 function across rodent models and human samples.

How should researchers optimize storage and handling of TM6SF2 Antibody, Biotin conjugated?

For optimal stability and performance of TM6SF2 Antibody, Biotin conjugated, researchers should follow these evidence-based storage and handling protocols:

• Store at 4°C for short-term use (up to 2 weeks)

• Maintain at -20°C for long-term storage

• Stringently avoid freeze-thaw cycles which significantly diminish antibody activity

• Upon receipt, immediately transfer to the appropriate storage temperature

• When preparing working dilutions, use fresh aliquots whenever possible

• Maintain sterile handling conditions to prevent microbial contamination

The formulation typically contains Tris, HCl/glycine buffer (pH 7.4-7.8), 30% glycerol, 0.5% BSA, along with cryo-protective agents, and HEPES, with 0.02% Sodium Azide as a preservative . This formulation is designed to maintain antibody stability and activity during storage and use.

What methodological approaches validate TM6SF2 Antibody specificity?

Validating antibody specificity is crucial for experimental integrity. For TM6SF2 Antibody, researchers should implement the following comprehensive validation protocol:

• Western blot validation: Confirm detection of proteins at the expected molecular weight (48/50 kDa for native TM6SF2) .

• Positive controls: Include recombinant TM6SF2 protein and liver tissue samples with known TM6SF2 expression. Western blots have demonstrated specific detection of recombinant mouse TM6SF2 while showing no cross-reactivity with empty vehicle controls .

• Genetic knockdown verification: Implement siRNA knockdown experiments targeting TM6SF2. Research has demonstrated that TM6SF2 siRNA inhibition reduces TM6SF2 mRNA levels in Huh7 and HepG2 cells to approximately 25% of control values, with corresponding protein reduction confirmed by Western blot analysis .

• Expression pattern correlation: Compare immunohistochemical staining patterns with established TM6SF2 expression profiles, which should show predominant expression in liver and intestinal tissues .

• Epitope blocking: Where applicable, perform blocking experiments with the immunizing peptide (derived from amino acid region 220-270 on mouse TM6SF2 protein) .

• Biotin-specific controls: For biotin-conjugated antibodies specifically, include avidin/streptavidin-only controls to account for potential endogenous biotin interference.

What experimental factors influence TM6SF2 detection in liver tissue samples?

Several critical factors can significantly impact TM6SF2 detection in liver tissues:

• Fixation protocols: For FFPE samples, optimal fixation duration (12-24 hours) in 10% neutral buffered formalin prevents epitope masking while preserving tissue morphology.

• Antigen retrieval methods: Heat-induced epitope retrieval (HIER) using citrate buffer (pH 6.0) has been validated for optimal TM6SF2 detection in paraffin sections, as demonstrated in immunohistochemistry studies of mouse liver .

• Background reduction strategies: Implementation of appropriate blocking (IHC Blocking Buffer) before antibody incubation minimizes non-specific binding, particularly important in fatty liver samples which may exhibit higher background .

• Disease-state variations: TM6SF2 expression levels vary significantly based on disease state, with elevated expression observed in patients with simple steatosis or nonalcoholic steatohepatitis compared to healthy controls .

• Zone-specific expression: TM6SF2 shows zonation patterns within the liver acinus, requiring careful consideration when analyzing incomplete liver biopsy samples.

• Detection systems: For biotin-conjugated antibodies, avidin-biotin signal amplification systems enhance sensitivity but require careful titration to prevent excessive background.

How does TM6SF2 knockdown affect triglyceride metabolism in hepatic models?

TM6SF2 knockdown produces significant and specific alterations in hepatic lipid metabolism. In human hepatoma cell lines (Huh7 and HepG2), TM6SF2 siRNA inhibition demonstrated:

• Reduction of TM6SF2 mRNA levels to 27 ± 7% and 24 ± 5% of control values in Huh7 and HepG2 cells, respectively (mean ± SD of n > 15) .

• Substantially decreased triglyceride secretion into media, measured using C14-labeled glycerol incorporation methodology .

• More modest reductions in apolipoprotein B (APOB) secretion, suggesting differential effects on the protein and lipid components of triglyceride-rich lipoproteins .

• Increased intracellular triglyceride accumulation, mirroring the hepatic steatosis phenotype observed in individuals carrying TM6SF2 loss-of-function variants .

These findings align with genome-wide association data demonstrating that genetic variants associated with reduced TM6SF2 expression correlate with reduced plasma triglyceride concentrations but increased hepatic fat content, supporting TM6SF2's critical role in triglyceride-rich lipoprotein secretion .

What is the relationship between TM6SF2 expression patterns and NAFLD progression?

The relationship between TM6SF2 expression and NAFLD progression reveals complex regulatory mechanisms:

• Transcriptomic analysis of liver samples from 80 cases showed significantly elevated TM6SF2 mRNA levels in both simple steatosis (SS, n=20) and nonalcoholic steatohepatitis (NASH, n=20) compared to healthy controls .

• This upregulation was independently confirmed through analysis of four separate transcriptomic datasets from the GEO database (GSE13970, GSE48452, GSE83452, and GSE89632) .

• Immunohistochemistry staining demonstrated a progressive increase in TM6SF2 protein expression correlating with increasing severity of steatosis .

• Paradoxically, genetic variants causing TM6SF2 deficiency enhance hepatic lipid accumulation through dysregulated fatty acid metabolism .

This apparent contradiction suggests TM6SF2 upregulation may represent a compensatory mechanism to facilitate triglyceride export from hepatocytes under lipid overload conditions. When this compensation is inadequate or when TM6SF2 function is impaired by genetic variants, progressive lipid accumulation and liver damage may ensue .

How do genetic variations in TM6SF2 impact experimental models of NAFLD?

Genetic variations in TM6SF2, particularly the E167K (rs58542926) polymorphism, significantly alter lipid metabolism in experimental NAFLD models:

• Divergent lipid distribution: Models with TM6SF2 loss-of-function variants show increased hepatic triglyceride content coupled with reduced circulating triglyceride and cholesterol levels .

• Enhanced steatosis susceptibility: Under high-fat diet conditions, TM6SF2-deficient models demonstrate accelerated and more severe hepatic steatosis development compared to wild-type controls .

• Differential response to lipid challenges: When challenged with palmitic acid (PA, 150 μmol/L), TM6SF2-knockdown L02 cells show significantly altered gene expression profiles compared to controls, with differential expression of genes involved in lipid metabolism pathways .

• Altered pharmacological responses: TM6SF2-deficient models show differential responses to therapeutic interventions, including MK-4074, suggesting genetic variation should be considered when evaluating potential NAFLD treatments .

These findings highlight the importance of considering TM6SF2 genetic status when designing experiments using NAFLD models and interpreting results, as genetic background significantly influences lipid metabolism phenotypes and treatment responses .

What strategies can resolve inconsistent TM6SF2 antibody staining in immunohistochemistry?

When encountering variable TM6SF2 staining patterns in immunohistochemistry, researchers should systematically address these technical challenges:

• Optimize antigen retrieval: Compare citrate buffer (pH 6.0) and EDTA buffer (pH 9.0) retrieval methods, as TM6SF2 epitopes demonstrated enhanced accessibility with optimized heat-induced epitope retrieval protocols .

• Antibody titration: Perform systematic dilution series (1:50, 1:100, 1:150) to identify optimal signal-to-noise ratio for specific tissue types. Validated protocols confirm 1:100 dilution in IHC Blocking Buffer as effective for mouse liver tissue .

• Signal amplification adjustment: For biotin-conjugated antibodies, calibrate avidin-biotin complex (ABC) incubation times to balance sensitivity and specificity.

• Sequential double-staining: To resolve zonal expression patterns in liver, implement double immunostaining with zonation markers (e.g., glutamine synthetase for pericentral areas).

• Comparative antibody validation: When possible, verify staining patterns with alternative TM6SF2 antibodies targeting different epitopes.

• Counterstain optimization: Adjust counterstain intensity (e.g., hematoxylin) to provide cellular context without obscuring specific TM6SF2 signal. Hemotoxylin QS has been validated as an effective counterstain for TM6SF2 immunohistochemistry .

How should researchers interpret contradictory data regarding TM6SF2 expression in different NAFLD stages?

Interpreting contradictory TM6SF2 expression data across NAFLD stages requires multi-dimensional analysis:

• Compensatory regulation mechanism: Initial TM6SF2 upregulation likely represents an adaptive response to facilitate triglyceride export from lipid-laden hepatocytes, as evidenced by increased expression in steatotic liver samples .

• Disease progression dynamics: Expression patterns may differ between early steatosis and advanced NASH due to progression-specific transcriptional regulation and cellular stress responses.

• Model-specific considerations: In vitro PA-stimulated steatosis models demonstrated TM6SF2 upregulation, potentially mimicking early NAFLD stages , while genetic knockdown models may better represent loss-of-function variant effects.

• Transcript versus protein level discrepancies: RNA-seq data from GEO databases showed elevated TM6SF2 mRNA in NAFLD patients , but post-transcriptional regulation may impact protein abundance differently.

• Genetic background influence: Population studies with different frequencies of TM6SF2 variants may yield apparently contradictory results if genetic status is not stratified in analysis.

When encountering contradictory data, researchers should systematically evaluate these factors and consider that TM6SF2's role may change throughout disease progression, from compensatory upregulation in early stages to potential dysregulation in advanced disease.

What controls are essential when evaluating TM6SF2 function in lipid metabolism experiments?

Robust experimental design for TM6SF2 functional studies requires comprehensive controls:

• Expression verification controls:

  • Positive controls: Liver tissue (high expression)

  • Negative controls: Tissues with minimal TM6SF2 expression

  • Western blot verification of protein expression levels before functional assays

• Genetic manipulation controls:

  • Non-targeting siRNA/shRNA controls (validated in Huh7 and HepG2 cells)

  • Multiple independent siRNA sequences (target sequence example: TGACCTGGCCCTTGTCATATA)

  • Rescue experiments using siRNA-resistant TM6SF2 constructs

• Lipid metabolism assay controls:

  • Time-course measurements confirming linear secretion rates

  • Size fractionation verifying appropriate lipoprotein fractions (VLDL-LDL range)

  • Controls for extracellular lipoprotein hydrolysis or reuptake

  • Normalization of triglyceride measurements to total protein levels

• Treatment controls:

  • Vehicle controls (BSA for fatty acid treatments)

  • Concentration response curves for treatments (e.g., palmitic acid at 150 μmol/L)

  • Positive control treatments with known effects on hepatic lipid metabolism

These controls ensure experimental rigor when investigating TM6SF2's complex role in lipid metabolism and validate findings regarding its function in triglyceride secretion and hepatic lipid accumulation .

How might advanced imaging techniques enhance TM6SF2 localization studies?

Emerging advanced imaging methodologies offer unprecedented opportunities for understanding TM6SF2 subcellular localization and dynamics:

• Super-resolution microscopy: Techniques like STORM or PALM can resolve TM6SF2 distribution within subcellular compartments beyond conventional microscopy limits, potentially revealing distinct pools within the ER-Golgi system.

• Live-cell imaging: Implementing fluorescent protein-tagged TM6SF2 constructs with biotin acceptor domains would enable real-time tracking of protein trafficking between cellular compartments in response to lipid challenges.

• Correlative light-electron microscopy (CLEM): Combining immunofluorescence using biotin-conjugated TM6SF2 antibodies with electron microscopy could precisely map TM6SF2 to specific membrane domains involved in lipid trafficking.

• Expansion microscopy: Physical expansion of cellular structures through hydrogel embedding followed by TM6SF2 immunolabeling could reveal previously undetectable spatial relationships with other lipid metabolism proteins.

• Multi-protein co-localization: Combining biotin-conjugated TM6SF2 antibody with differently labeled markers for VLDL assembly components could elucidate the sequential steps in triglyceride-rich lipoprotein formation.

These techniques hold potential to resolve the precise spatial organization of TM6SF2 within the complex network of organelles involved in hepatic lipid metabolism .

What are the methodological considerations for studying TM6SF2 post-translational modifications?

Investigating TM6SF2 post-translational modifications (PTMs) requires specialized methodological approaches:

• Mass spectrometry-based identification:

  • Immunoprecipitation using TM6SF2 antibodies followed by LC-MS/MS analysis

  • Enrichment strategies for specific modifications (phosphopeptides, glycopeptides)

  • Quantitative proteomics to compare PTM profiles between normal and steatotic conditions

• Site-directed mutagenesis validation:

  • Systematic mutation of predicted modification sites

  • Functional assessment of mutants in triglyceride secretion assays

  • Localization studies of PTM-deficient mutants

• PTM-specific antibody development:

  • Generation of antibodies recognizing specific TM6SF2 modifications

  • Validation using in vitro modified recombinant proteins

  • Application in tissue samples representing different NAFLD stages

• Temporal dynamics:

  • Pulse-chase experiments to track modification kinetics

  • Correlation with lipid challenge responses

  • Investigation of modification changes during ER stress conditions

These approaches would provide critical insights into how post-translational regulation of TM6SF2 may contribute to its function in lipid metabolism and potential dysregulation in NAFLD .

How can multi-omics approaches advance understanding of TM6SF2 regulatory networks?

Integrative multi-omics strategies offer powerful frameworks for comprehensively mapping TM6SF2 regulatory networks:

• Transcriptomic-proteomic integration:

  • Correlation of TM6SF2 mRNA upregulation observed in NAFLD with protein-level changes

  • Identification of post-transcriptional regulatory mechanisms

  • Discovery of co-regulated gene clusters suggesting functional relationships

• Lipidomic profiling:

  • Comprehensive characterization of lipid species alterations in TM6SF2-deficient models

  • Identification of specific lipid signatures associated with TM6SF2 variants

  • Correlation of lipid profiles with disease progression markers

• Chromatin accessibility mapping:

  • Analysis of regulatory elements controlling TM6SF2 expression

  • Identification of transcription factors responding to metabolic signals

  • Integration with genetic variant data to explain expression differences

• Interactome analysis:

  • Proteomics-based identification of TM6SF2 protein interaction partners

  • Validation using proximity labeling approaches (BioID, APEX)

  • Network analysis to position TM6SF2 within lipid metabolism pathways

• Systems biology modeling:

  • Integration of multiple data types into predictive models

  • Simulation of perturbations to identify key regulatory nodes

  • Therapeutic target identification based on network vulnerabilities

These integrated approaches would provide unprecedented insights into TM6SF2's role within the complex regulatory networks governing hepatic lipid metabolism, potentially revealing new therapeutic opportunities for NAFLD .