TMEM14A Antibody

What is TMEM14A and what is its basic structure?

TMEM14A (Transmembrane protein 14A) is a 99 amino acid integral membrane protein with three transmembrane domains. Its structure has been identified through nuclear magnetic resonance spectroscopy. TMEM14A primarily localizes in mitochondria and belongs to the transmembrane (TMEM) protein family, several members of which have been identified as having oncogenic properties . Understanding its structure is essential for interpreting functional studies, as the three transmembrane domains suggest potential interaction with membrane-associated signaling pathways.

Where is TMEM14A primarily expressed in human tissues?

TMEM14A shows differential expression across tissues, with particularly high expression in podocytes within the kidney. Research demonstrates that TMEM14A mRNA expression is highest in differentiated podocytes compared to other cell types such as human embryonic kidney (HEK) cells and human umbilical vein endothelial cells (HUVEC) . Within the kidney, expression is higher in isolated glomeruli than in whole kidney tissue, suggesting enrichment in glomerular structures. Immunohistochemistry has also revealed TMEM14A expression in distal tubular cells. In pathological contexts, TMEM14A shows elevated expression in ovarian cancer tissues compared to para-carcinoma tissues .

What cellular functions has TMEM14A been associated with?

At the cellular level, TMEM14A performs multiple functions. It has been implicated in preventing apoptosis by preserving mitochondrial membrane potential through Bax suppression . In ovarian cancer cells, TMEM14A has been shown to inhibit cell apoptosis while accelerating energy metabolism, including both glycolysis and oxygen respiration . These findings suggest that TMEM14A may serve as a metabolic regulator at the mitochondrial level. Additionally, TMEM14A has been positively correlated with c-MYC expression in ovarian cancer, with overexpression of c-Myc rescuing the function of TMEM14A in experimental models .

What considerations are important when selecting a TMEM14A antibody?

When selecting a TMEM14A antibody for research applications, several critical factors should be considered:

• Application compatibility: Ensure the antibody has been validated for your specific application (WB, IHC, IF, ELISA). For example, commercially available polyclonal antibodies have been validated for multiple applications including ELISA, Western blot, immunohistochemistry, and immunofluorescence .

• Species reactivity: Verify that the antibody recognizes TMEM14A from your species of interest. Some antibodies are specific to human TMEM14A, while others may have cross-reactivity with multiple species .

• Epitope recognition: Consider which region of TMEM14A the antibody targets. For example, antibodies raised against amino acids 45-78 of human TMEM14A target a specific epitope that might be more accessible in certain applications .

• Antibody format:

  • Host species (e.g., rabbit, goat) should be selected to avoid cross-reactivity with other antibodies in multi-color staining

  • Clonality (monoclonal vs. polyclonal) affects specificity and sensitivity

  • Conjugation status (unconjugated vs. fluorophore/enzyme-conjugated)

• Validation evidence: Prioritize antibodies with published validation data including positive/negative controls and citation in peer-reviewed publications.

What is the optimal protocol for TMEM14A immunohistochemistry?

Based on published research, the following protocol has been successfully used for TMEM14A immunohistochemistry:

For Formalin-Fixed Paraffin-Embedded Tissue:

• Section tissues at 4 μm thickness

• Deparaffinize and dehydrate sections

• Perform antigen retrieval by boiling in Tris/EDTA buffer for 10 minutes

• Wash in PBS

• Incubate with primary antibody diluted in 1% BSA in PBS:

  • Polyclonal goat anti-TMEM14A (such as Santa Cruz Biotech, sc-248899)

  • Dilution: 1:200 for rat tissue, 1:150 for human tissue

  • Incubate at 4°C overnight

• Wash in PBS

• Incubate for 30 minutes with secondary antibody:

  • Polyclonal Rabbit Anti-Goat Immunoglobulins/horseradish peroxidase

• Wash in PBS

• Detect immunoreactivity with diaminobenzidine

• Counterstain with hematoxylin

• Dehydrate and mount

For Cultured Cells:

• Transfer confluent cells to small glasses in a 24-well plate

• After 24 hours incubation, wash cells in PBS

• Fixate using -20°C methanol

• Wash in PBS

• Block with 5% Normal Rabbit Serum (NRS) for 1 hour

• Aspirate NRS and incubate with primary antibody diluted in 1% BSA in PBS at 4°C overnight

• Continue with secondary antibody and detection as described above

Note that while this protocol works well for human and rat material, the quality of staining has been reported as insufficient for reliable assessment in zebrafish material .

How can I validate the specificity of a TMEM14A antibody?

Validating antibody specificity is crucial for reliable TMEM14A research. Implement these methodological approaches:

• Positive and negative controls:

  • Use tissues or cell lines with known high expression (e.g., differentiated podocytes) as positive controls

  • Include tissues from TMEM14A knockout models or cells with TMEM14A knockdown as negative controls

• Peptide competition assay:

  • Pre-incubate the antibody with excess immunizing peptide before application

  • Loss of signal confirms specificity for the target epitope

• Cross-validation with multiple antibodies:

  • Compare staining patterns using antibodies targeting different TMEM14A epitopes

  • Consistent patterns increase confidence in specificity

• Multiple detection methods:

  • Compare results between immunohistochemistry, Western blot, and immunofluorescence

  • Verify that molecular weight in Western blot corresponds to predicted TMEM14A size

• Genetic manipulation validation:

  • Compare staining in wild-type versus TMEM14A-knockdown cells

  • Significant reduction in signal should be observed in knockdown samples

• Species cross-reactivity testing:

  • If the antibody claims multi-species reactivity, test across relevant species

  • Note that some antibodies may not perform equally across species (e.g., limited efficacy in zebrafish reported)

How is TMEM14A involved in ovarian cancer progression?

TMEM14A has been identified as a potential oncogenic factor in ovarian cancer progression through multiple mechanisms. Research has demonstrated that TMEM14A is highly expressed in ovarian cancer tumors compared to para-carcinoma tissues, and this elevated expression correlates with higher mortality rates in patients .

Mechanistically, TMEM14A promotes ovarian cancer development by:

• Inhibiting apoptosis: TMEM14A reduces cancer cell death, promoting tumor cell survival

• Enhancing energy metabolism: TMEM14A accelerates both glycolysis and oxygen respiration, providing metabolic advantages to cancer cells

• Interacting with oncogenic pathways: TMEM14A positively correlates with c-MYC expression, with overexpression of c-Myc rescuing the function of TMEM14A in experimental models

Functional studies using RNA interference and lentiviral-mediated vector systems have demonstrated that knockdown of TMEM14A suppresses the growth of human ovarian cancer cells by blocking glycolysis activity . These findings suggest TMEM14A may serve as both a diagnostic and prognostic biomarker for early detection of ovarian cancer and potentially as a therapeutic target.

What methodological approaches can be used to study TMEM14A in cancer cell lines?

Several robust methodological approaches have proven effective for studying TMEM14A in cancer cell lines:

• Expression Modulation:

  • RNA interference (siRNA) for transient knockdown

  • Lentiviral-mediated vector systems for stable knockdown or overexpression

  • CRISPR-Cas9 for gene editing

• Functional Assays:

  • Flow cytometric analysis to examine cell apoptosis

  • Seahorse XF24 analyzer to determine oxygen consumption and extracellular acidification

  • Cell proliferation assays to assess growth effects

• Molecular Interaction Studies:

  • Chromatin immunoprecipitation assay to determine the connection between TMEM14A and transcription factors like c-Myc

  • Co-immunoprecipitation to identify protein-protein interactions

• In Vivo Validation:

  • Xenograft mice models using transfected cancer cell lines

  • Immunohistochemical staining to determine expression patterns of TMEM14A and related factors in tumor tissues

For example, one study used CAOV3 ovarian cancer cells with lentivirus transfection, achieving over 80% transfection rate as verified by RT-qPCR after 72 hours . Cell culture conditions typically involve RPMI 1640 Medium with added antibiotics, insulin, transferrin, selenite, and 10% fetal bovine serum.

How does TMEM14A expression correlate with cancer prognosis?

This prognostic value may stem from TMEM14A's dual role in inhibiting apoptosis and enhancing metabolic activity in cancer cells. By promoting cell survival and providing metabolic advantages, TMEM14A appears to contribute to more aggressive tumor behavior.

When analyzing TMEM14A expression for prognostic purposes, researchers should consider:

• Expression levels relative to matched normal tissues

• Correlation with established markers like c-Myc

• Association with clinical variables including stage and grade

• Standardization of quantification methods across studies

Importantly, TMEM14A has been observed to be deregulated in multiple cancer types, including hepatocellular carcinoma and colorectal cancer, suggesting its potential as a broader cancer biomarker beyond ovarian cancer .

What role does TMEM14A play in the glomerular filtration barrier?

TMEM14A has been identified as a critical protein required for maintaining the integrity of the glomerular filtration barrier (GFB). Research indicates that TMEM14A expression is diminished before the onset of proteinuria in spontaneously proteinuric rat models, suggesting a protective role in normal kidney function .

Experimentally, knocking down tmem14a mRNA translation in zebrafish embryos resulted in proteinuria without affecting tubular reabsorption, directly implicating TMEM14A in GFB maintenance . The molecular mechanisms through which TMEM14A protects the GFB may relate to its role in preventing apoptosis. Since podocyte apoptosis and detachment have been implicated in proteinuric renal diseases, TMEM14A's anti-apoptotic function may be critical for maintaining podocyte viability and thus GFB integrity.

Interestingly, TMEM14A expression patterns change with age and disease state. In healthy control rats (SHR), glomerular TMEM14A mRNA expression was significantly higher at younger ages (weeks 2, 4, and 6) compared to older ages (weeks 8 and 10), suggesting developmental regulation . In proteinuric models, this normal expression pattern is disrupted, with consistently lower expression at all time points.

How can TMEM14A expression be effectively silenced in research models?

Several approaches have been validated for silencing TMEM14A expression in different research models:

For Cell Culture Models:

• RNA Interference (siRNA):

  • Culture cells to 80% confluence

  • Incubate in serum-free medium for 4 hours

  • Transfect with siRNA targeting TMEM14A using commercial transfection reagents

  • Confirm knockdown efficiency by RT-qPCR after 48-72 hours

• Lentiviral-Mediated Knockdown:

  • Seed cells (e.g., 1.5 × 10^5 cells/well) in a 12-well plate and culture to 80% confluence

  • Incubate in serum-free medium for 4 hours

  • Transfect with lentiviruses carrying shRNA targeting TMEM14A

  • After 3 days, filter transfected cells using a 0.45 μM mesh

  • Concentrate the viral suspension at 70,000 × g at 4°C for 2 hours

  • Collect supernatant for viral titer determination

  • Culture target cells with diluted lentiviruses

  • Screen for transfection rate at 72 hours (aim for >80% transfection)

  • Confirm knockdown efficiency by RT-qPCR

For Zebrafish Models:

• Use morpholino injection to block mRNA translation of the zebrafish TMEM14A homologue (zgc:163080)

• Verify knockdown through RT-qPCR

• Assess functional effects using dextran tracer injection (3 and 70 kDa) to evaluate filtration barrier integrity

For quantifying knockdown efficiency by RT-qPCR, the following human TMEM14A primers have been validated:

• Forward: TTTGGTTATGCAGCCCTCGT

• Reverse: ATAGCCGGCCAAACATCCAA

• Target mRNA sequence: NM_014051.3

Housekeeping genes such as GAPDH or HPRT1 should be used as internal controls for normalization.

What experimental models are available for studying TMEM14A in kidney disease?

Several experimental models have proven effective for studying TMEM14A function in kidney disease:

• Rat Models:

  • The Dahl salt-sensitive rat has been used as a spontaneously proteinuric model where TMEM14A expression is diminished before proteinuria onset

  • Spontaneously hypertensive rats (SHR) serve as controls

  • These models allow temporal analysis of TMEM14A expression in relation to disease progression

• Zebrafish Embryo Models:

  • Knockdown of the zebrafish TMEM14A homologue (zgc:163080) using morpholino injection

  • Functional assessment using dextran tracer injection (3 and 70 kDa) to evaluate filtration barrier integrity

  • Puromycin aminonucleoside (PAN) injection as a positive control for inducing proteinuria

• Cell Culture Systems:

  • Immortalized podocytes for in vitro studies of TMEM14A function

  • Comparison with HEK293 and HUVEC cells to assess tissue-specific effects

  • Transfection experiments to modulate TMEM14A expression

• Human Tissue Analysis:

  • Immunohistochemical staining of TMEM14A in kidney biopsies from patients with various proteinuric renal diseases

  • Comparative analysis of expression patterns in diseased versus healthy tissue

The table below summarizes genes found to be differentially expressed in proteinuric rat models, including TMEM14A:

This table highlights that TMEM14A showed a 3-fold decrease in expression in proteinuric models .

How should researchers normalize TMEM14A expression data?

Proper normalization of TMEM14A expression data is critical for accurate interpretation across different experimental conditions. Based on published methodologies, the following approaches are recommended:

For RT-qPCR Data:

• Reference Gene Selection:

  • For cell culture experiments, GAPDH has been successfully used as a housekeeping gene

  • For purified glomeruli experiments, HPRT1 has been recommended as an internal control

  • Consider using multiple reference genes for more robust normalization

• Calculation Method:

  • Use the comparative Ct (2^-ΔΔCt) method for relative quantification

  • Express TMEM14A mRNA levels relative to the reference gene(s)

  • Software such as Bio-Rad CFX Maestro has been used for normalized gene expression calculations

For Protein Expression Data:

• Western Blot Normalization:

  • Normalize to housekeeping proteins such as β-actin, GAPDH, or α-tubulin

  • Consider total protein normalization methods for more accurate quantification

• Immunohistochemistry Quantification:

  • Use digital image analysis with standardized acquisition settings

  • Quantify staining intensity and/or percentage of positive cells

  • Include internal controls within each experiment

The table below provides validated primer sequences for TMEM14A expression analysis:

These validated primers ensure reliable quantification of TMEM14A expression .

How can contradictory TMEM14A expression data be reconciled?

When faced with contradictory TMEM14A expression data across studies or experimental conditions, researchers should implement systematic approaches to reconcile these differences:

1. Methodological Assessment:

• Detection Method Differences: Compare RT-qPCR, Western blot, and immunohistochemistry results, as each method has different sensitivities and specificities

• Antibody Specificity: Different antibodies may recognize different epitopes or isoforms of TMEM14A

• Protocol Variations: Consider differences in tissue processing, fixation methods, and staining protocols

2. Biological Variables:

• Cell Type Specificity: TMEM14A is differentially expressed across cell types, with highest expression in differentiated podocytes

• Developmental Stages: TMEM14A expression changes with development, with higher expression at younger ages in rat models

• Disease Context: TMEM14A shows elevated expression in ovarian cancer tissues but decreased expression in proteinuric kidney disease models

3. Analytical Approaches:

• Meta-analysis: Pool data across studies with similar methodologies to identify consistent trends

• Subgroup Analysis: Stratify results by relevant variables (tissue type, disease stage, age)

• Correlation with Functional Outcomes: Relate expression data to functional readouts

4. Validation Strategies:

• Orthogonal Methods: Confirm findings using multiple independent techniques

• Alternative Models: Test expression in multiple model systems

• Genetic Manipulation: Use knockdown/overexpression to establish causal relationships

What are common pitfalls in analyzing TMEM14A expression across different tissues?

Researchers analyzing TMEM14A expression across different tissues should be aware of several potential pitfalls:

1. Tissue Heterogeneity:
TMEM14A shows differential expression across cell types within the same organ. For example, in the kidney, it is primarily expressed in podocytes but also in distal tubular cells . Using whole-tissue homogenates without accounting for this heterogeneity can mask cell-specific changes in expression.

3. Disease-Induced Cellular Changes:
In disease states, the cellular composition of tissues can change (e.g., through inflammatory infiltrates or fibrosis). These changes can alter the apparent expression of TMEM14A independent of actual per-cell expression changes.

4. Antibody Specificity Issues:
Different antibodies may recognize different epitopes or isoforms of TMEM14A, potentially leading to discrepant results. The quality of staining has been reported as insufficient for reliable assessment in some species (e.g., zebrafish) , highlighting the importance of antibody validation.

5. Post-Transcriptional Regulation:
mRNA and protein levels may not correlate due to post-transcriptional regulation. Studies have shown that TMEM14A protein expression was lower in Dahl rats than in SHR at all time points after 2 weeks of age, which was significantly so at 4 and 8 weeks of age, suggesting complex regulation .

6. Experimental Variability:
Technical variables such as tissue processing, fixation methods, and staining protocols can significantly impact detected expression levels. For example, different dilutions of the same antibody have been recommended for different tissues (1:200 for rat tissue, 1:150 for human tissue) .

What are the emerging applications of TMEM14A research?

TMEM14A research is expanding into several promising directions that may significantly impact both basic science and clinical applications:

• Biomarker Development:

  • TMEM14A has potential as a diagnostic and prognostic biomarker for ovarian cancer

  • Early detection of kidney disease progression through monitoring TMEM14A expression changes

  • Development of non-invasive detection methods (e.g., urinary or circulating TMEM14A)

• Therapeutic Target Exploration:

  • Modulation of TMEM14A to inhibit cancer cell metabolism and growth

  • Preservation or enhancement of TMEM14A expression to protect podocyte function in kidney disease

  • Development of small molecule inhibitors or activators targeting TMEM14A-dependent pathways

• Mechanistic Investigations:

  • Elucidation of the complete signaling network connecting TMEM14A to c-Myc and other oncogenic pathways

  • Clarification of TMEM14A's role in mitochondrial function and cellular energy metabolism

  • Investigation of potential post-translational modifications affecting TMEM14A function

• Advanced Imaging Applications:

  • Development of live-cell imaging techniques to monitor TMEM14A dynamics in real-time

  • Super-resolution microscopy to investigate TMEM14A's precise subcellular localization

  • Correlative light and electron microscopy to link TMEM14A localization with ultrastructural features

These emerging applications underscore the importance of continuing to refine TMEM14A detection methodologies and expand our understanding of its biological functions across different tissues and disease states.

What methodological advances are needed for better TMEM14A research?

Several methodological advances would significantly enhance TMEM14A research:

• Improved Antibody Development:

  • Generation of more specific monoclonal antibodies targeting different TMEM14A epitopes

  • Development of antibodies with broader species cross-reactivity, particularly for zebrafish models where current antibodies show limited efficacy

  • Creation of phospho-specific antibodies to detect potential regulatory post-translational modifications

• Advanced Genetic Models:

  • CRISPR-engineered cell lines and animal models with conditional TMEM14A knockout/knockin

  • Reporter systems to monitor TMEM14A expression in real-time

  • Humanized animal models expressing human TMEM14A variants

• Structural Biology Approaches:

  • High-resolution crystal or cryo-EM structures of TMEM14A in different functional states

  • Molecular dynamics simulations to understand conformational changes

  • Protein-protein interaction mapping through proximity labeling approaches

• Single-Cell Technologies:

  • Single-cell RNA sequencing to map TMEM14A expression across all cell types in tissues of interest

  • Single-cell proteomics to correlate TMEM14A protein levels with mRNA expression

  • Spatial transcriptomics to maintain tissue context while assessing cell-specific expression

• Functional Assays:

  • Development of high-throughput screening assays for TMEM14A modulators

  • More sensitive assays to quantify TMEM14A's effects on mitochondrial function

  • Standardized methods to assess TMEM14A's impact on the glomerular filtration barrier

These methodological advances would address current limitations in TMEM14A research and facilitate more comprehensive investigations into its functions across different biological contexts.