TMEM237 Antibody, Biotin conjugated

What is TMEM237 and what role does it play in cellular function?

TMEM237, previously known as ALS2CR4, is a tetraspan transmembrane protein that localizes to the ciliary transition zone (TZ). It plays a critical role in ciliogenesis, which is the formation of cilia - specialized cellular projections that function in cellular signaling and mechanosensation. TMEM237 has been identified as a component of a functional module within the transition zone that regulates proper ciliary function . Studies have demonstrated that loss of mammalian TMEM237 results in defective ciliogenesis and deregulation of Wnt signaling pathways, suggesting its importance in developmental processes .

The protein has also been implicated in the pathogenesis of Joubert syndrome related disorders (JSRDs), which are characterized by cerebellar vermis hypoplasia and other developmental abnormalities. TMEM237 functionally interacts with other transition zone proteins such as NPHP4, MKS2/TMEM216, MKSR-1/B9D1, and MKSR-2/B9D2, forming a complex interaction network essential for ciliary function . Moreover, recent research has identified TMEM237 as a hypoxia-responsive gene that plays a role in hepatocellular carcinoma progression through its interaction with NPHP1 and subsequent activation of the Pyk2/ERK pathway .

How should researchers store and handle TMEM237 Antibody, Biotin conjugated?

The TMEM237 Antibody, Biotin conjugated should be stored at -20°C or -80°C upon receipt to maintain its stability and activity. Researchers should avoid repeated freeze-thaw cycles as this can lead to protein denaturation and loss of antibody function . The antibody is supplied in liquid form, typically in a buffer containing 50% Glycerol and 0.01M PBS at pH 7.4, with 0.03% Proclin 300 as a preservative . This formulation helps maintain antibody stability during storage.

When handling the antibody, standard laboratory safety protocols should be followed, including wearing appropriate personal protective equipment. For experimental use, the antibody should be thawed on ice or at 4°C and briefly centrifuged to collect the solution at the bottom of the tube before pipetting. Working aliquots can be prepared to minimize freeze-thaw cycles of the stock solution. The antibody should be kept on ice during experiments and returned to storage promptly after use to preserve its activity and specificity for TMEM237 detection .

What applications is the TMEM237 Antibody, Biotin conjugated suitable for?

The TMEM237 Antibody, Biotin conjugated is primarily validated for Enzyme-Linked Immunosorbent Assay (ELISA) applications according to the product information . The biotin conjugation provides a significant advantage for detection methodologies, as it allows for signal amplification through streptavidin-based detection systems, enhancing sensitivity in assays where target protein abundance may be low.

What is known about TMEM237 expression patterns in normal and disease states?

TMEM237 expression shows significant variation between normal and disease states, particularly in hepatocellular carcinoma (HCC). Analysis of multiple datasets including TCGA, GSE76297, and GSE45436 has consistently demonstrated that TMEM237 is significantly upregulated in HCC tissues compared to adjacent non-tumor tissues . This overexpression has been verified at both mRNA and protein levels using RT-qPCR, Western blotting, and immunohistochemistry techniques.

In HCC cell lines (Huh7, PLC/PRF/5, HepG2, MHCC97L, MHCC97H, and HCCLM3), TMEM237 shows higher expression compared to the immortalized normal hepatocyte cell line MIHA . Clinical correlation studies indicate that higher TMEM237 expression is significantly associated with larger tumor size (≥5cm), multiple tumor nodules, advanced TNM stage (III+IV), and presence of venous infiltration . These clinical associations suggest that TMEM237 may serve as a potential biomarker for HCC progression and metastasis.

In normal tissues, TMEM237 plays a role in ciliary function, and its mutation has been linked to Joubert syndrome related disorders, indicating its importance in normal developmental processes . The differential expression pattern between normal and diseased states makes TMEM237 an interesting target for both basic and translational research.

What methodologies are recommended for studying TMEM237's role in ciliogenesis?

Investigating TMEM237's role in ciliogenesis requires a multi-faceted approach combining genetic manipulation, protein localization studies, and functional assays. RNAi knockdown has proven effective, with siRNA duplexes designed against specific sequences of mouse Tmem237 (such as duplex 1: 5′-GGAUCUUAGUGAAGAGUUATT and duplex 2: 5′-GAACGAAAACGGCAUUGAUTT) . These can be transfected into relevant cell lines (such as IMCD3 cells) using Lipofectamine RNAiMax, with medium or low GC non-targeting scrambled siRNA duplexes serving as negative controls.

For in vivo studies, morpholino oligonucleotides have been successfully employed in zebrafish models to knockdown tmem237 expression. Specific morpholinos targeting tmem237a (5′-TTGTCTGTGTGAAAGGCAGAAATCA-3′) and tmem237b (5′-TGGAAACCTACACTTAACAATATGT-3′) can be microinjected into one-two cell stage embryos . The resulting phenotypes can be assessed for ciliary defects, particularly gastrulation abnormalities that are consistent with ciliary dysfunction.

Protein localization studies using immunofluorescence microscopy are essential for determining TMEM237's subcellular distribution. Antibodies against TMEM237 can be used in conjunction with markers for the ciliary transition zone to confirm localization. Additionally, co-localization studies with other TZ proteins (NPHP4, MKS2/TMEM216, MKSR-1/B9D1, and MKSR-2/B9D2) can help elucidate functional interactions within this complex . These techniques, combined with functional assays of ciliary signaling pathways (such as Wnt signaling), provide a comprehensive approach to studying TMEM237's role in ciliogenesis.

How can researchers effectively use TMEM237 antibodies to study protein-protein interactions in the ciliary transition zone?

Studying protein-protein interactions involving TMEM237 in the ciliary transition zone requires specialized approaches that maintain the integrity of these interactions. Co-immunoprecipitation (Co-IP) assays are fundamental for this purpose and can be performed using TMEM237 antibodies to pull down protein complexes from cell lysates. Based on research methodologies, IP-MS (immunoprecipitation followed by mass spectrometry) has been successfully employed to identify novel interaction partners of TMEM237 .

For verifying specific interactions, reciprocal Co-IPs should be performed, where antibodies against suspected interaction partners (such as NPHP1, NPHP4, MKS2/TMEM216) are used to precipitate complexes, followed by Western blotting with TMEM237 antibody. The biotin-conjugated format of TMEM237 antibody can be particularly advantageous in these contexts when used with streptavidin-based detection systems, potentially enhancing sensitivity.

Proximity ligation assays (PLA) represent another powerful approach for studying TMEM237 interactions in situ, allowing visualization of protein-protein interactions within intact cells. This technique involves using primary antibodies against TMEM237 and its potential interaction partner, followed by secondary antibodies conjugated with oligonucleotides that, when in close proximity, can be ligated and amplified for detection . Additionally, genetic interaction studies in model organisms such as C. elegans have proven valuable, as demonstrated by the interaction between jbts-14 (the C. elegans ortholog of TMEM237) and nphp-4 in controlling basal body-TZ anchoring and ciliogenesis .

What experimental approaches are recommended for investigating TMEM237's role in hepatocellular carcinoma?

Investigating TMEM237's role in hepatocellular carcinoma (HCC) requires a comprehensive experimental approach combining in vitro cellular studies, in vivo animal models, and clinical sample analysis. For cellular studies, gain- and loss-of-function experiments are essential. Stable TMEM237 overexpression can be established in HCC cell lines with relatively low endogenous TMEM237 levels (such as Hep3B and Huh7), while knockdown can be performed in cell lines with high endogenous expression (such as HCCLM3 and PLC/PRF/5) .

The functional consequences of TMEM237 modulation should be assessed using proliferation assays (CCK-8, colony formation, EdU), migration and invasion assays (Transwell), and EMT marker analysis (Western blotting for E-cadherin, N-cadherin, and vimentin) . To explore the molecular mechanisms, researchers should investigate TMEM237's interaction with NPHP1 and its effect on Pyk2 phosphorylation and ERK1/2 activation using co-immunoprecipitation and Western blotting techniques.

For in vivo studies, subcutaneous xenograft models using HCC cells with TMEM237 overexpression or knockdown can evaluate effects on tumor growth. Additionally, pulmonary metastatic models help assess TMEM237's impact on metastatic potential . Immunohistochemical analysis of xenograft tissues for proliferation markers (Ki67) and EMT markers (E-cadherin, N-cadherin, vimentin) provides further insights into TMEM237's mechanistic role.

Clinical relevance should be established through analysis of TMEM237 expression in HCC patient samples using RT-qPCR, Western blotting, and IHC, correlating expression levels with clinicopathological features and patient outcomes . This multi-faceted approach provides comprehensive understanding of TMEM237's role in HCC progression.

How should researchers design experiments to study the regulation of TMEM237 by hypoxia-inducible factors?

Studying the regulation of TMEM237 by hypoxia-inducible factors (HIFs) requires carefully designed experiments addressing both the transcriptional regulation and functional consequences. To establish hypoxic conditions, researchers should culture cells in hypoxic chambers (1% O2, 5% CO2, 94% N2) or use chemical mimetics of hypoxia such as cobalt chloride (CoCl2) or deferoxamine (DFO), comparing results to normoxic controls (21% O2) .

For investigating transcriptional regulation, luciferase reporter assays are essential. The wild-type TMEM237 promoter and versions with mutations in predicted hypoxia-response elements (HREs) should be cloned into pGL3 vectors and transfected into cells (such as HEK293T). After culture under hypoxic conditions for 48 hours, luciferase activities should be measured using a Dual-Luciferase Reporter Assay system, with Renilla luciferase activity for normalization .

Chromatin immunoprecipitation (ChIP) assays are crucial for confirming direct binding of HIF-1α to the TMEM237 promoter. After culturing cells under normoxic and hypoxic conditions for 16 hours, cells should be cross-linked and sonicated, and lysates incubated with antibodies against HIF-1α or IgG (control). The immunoprecipitated chromatin can then be analyzed by RT-qPCR using primers specific to the TMEM237 HRE region (forward: 5′-GAACCTTTCGCAGATTTCACA, reverse: TTTCCTTGTAGGCCGATTTG) .

To establish the functional significance of HIF-1α-mediated TMEM237 regulation, researchers should perform rescue experiments where HIF-1α is knocked down in hypoxic conditions, followed by TMEM237 overexpression. Functional assays (proliferation, migration, invasion) can then determine if TMEM237 overexpression rescues the phenotypes caused by HIF-1α knockdown, establishing TMEM237 as a critical downstream mediator of hypoxia-induced effects .

What controls and validation steps are critical when using TMEM237 Antibody, Biotin conjugated in experimental workflows?

When using TMEM237 Antibody, Biotin conjugated in experimental workflows, rigorous controls and validation steps are essential to ensure reliable and reproducible results. First, antibody specificity must be validated through multiple approaches. Western blotting using cell lysates from both TMEM237-expressing cells and those with TMEM237 knockdown or knockout serves as a primary validation method . The antibody should detect a band of the expected molecular weight in expressing cells, with reduced or absent signal in knockdown/knockout samples.

For immunohistochemistry or immunofluorescence applications, peptide competition assays provide another validation approach, where pre-incubation of the antibody with the immunizing peptide should abolish specific staining. Additionally, parallel staining with alternative TMEM237 antibodies targeting different epitopes can confirm staining patterns .

Experimental controls should include isotype controls (using non-specific IgG of the same species and isotype) to assess non-specific binding. For biotin-conjugated antibodies specifically, endogenous biotin blocking steps may be necessary, particularly in tissues with high biotin content. Streptavidin-only controls (omitting primary antibody) help identify endogenous biotin signal .

For functional studies, silencing RNA controls are critical when studying TMEM237 function. Both negative controls (non-targeting scrambled siRNA duplexes) and positive controls (siRNAs targeting genes with known phenotypes) should be included . When overexpressing TMEM237, empty vector controls are essential for distinguishing specific effects from transfection artifacts. These comprehensive validation steps and controls ensure that experimental results accurately reflect TMEM237 biology rather than technical artifacts.

How does TMEM237 expression correlate with clinical outcomes in hepatocellular carcinoma patients?

TMEM237 expression demonstrates significant correlations with multiple clinicopathological parameters and outcomes in hepatocellular carcinoma patients. Analysis of 90 pairs of HCC and adjacent non-tumor tissues revealed consistently elevated TMEM237 expression in tumor samples at both mRNA and protein levels . This overexpression pattern has been independently confirmed through analysis of multiple public datasets including TCGA, GSE76297, and GSE45436.

Clinical correlation studies have established that high TMEM237 expression is significantly associated with aggressive tumor features. Specifically, patients with high TMEM237 expression are more likely to present with larger tumor size (≥5cm, p=0.011), multiple tumor nodules (p=0.042), advanced TNM stage (III+IV, p=0.005), and presence of venous infiltration (p=0.003) . These associations are summarized in Table 1 from the research data, which presents a comprehensive analysis of TMEM237 expression in relation to various clinical parameters.

The prognostic significance of TMEM237 expression is substantial, with high expression levels associated with poor clinical outcomes in HCC patients. While specific survival data details are not fully elaborated in the provided search results, the strong correlation with advanced disease features (TNM stage III+IV and venous infiltration) strongly suggests that TMEM237 overexpression contributes to more aggressive disease behavior and potentially reduced survival . These clinical correlations, coupled with functional studies demonstrating TMEM237's role in promoting proliferation, migration, invasion, and EMT in HCC cells, position TMEM237 as both a potential prognostic biomarker and therapeutic target in HCC.

What methodologies are recommended for analyzing TMEM237 in clinical specimens?

Analysis of TMEM237 in clinical specimens requires a multi-modal approach to ensure comprehensive and reliable evaluation. RNA extraction from tissue samples should be performed using validated methods such as RNAfast200 (or similar commercial kits) following manufacturer's protocols, followed by cDNA synthesis using appropriate reverse transcription kits. For quantitative assessment of TMEM237 mRNA expression, RT-qPCR using SYBR Green-based detection is recommended with the following primer sequences: 5′-AGAGCACCATGAGGACTGAC (forward) and 5′-AGTTGATGGCTCATTGCCCT (reverse), with β-actin as a reference gene using primers 5′-ACTCGTCATACTCCTGCT (forward) and 5′-GAAACTACCTTCAACTCC (reverse) .

For protein-level detection, immunohistochemistry (IHC) represents the gold standard for clinical specimens. The methodology involves dewaxing and hydrating paraffin-embedded sections, followed by heat-induced antigen retrieval. Samples should be incubated with primary TMEM237 antibody overnight at 4°C, followed by incubation with appropriate secondary antibody at room temperature for 10 minutes. For evaluation, a semi-quantitative scoring system is recommended, combining staining intensity (0-3 scale: negative, weak, medium, strong) with percentage of positive cells (0-4 scale: negative, 1-25%, 26-50%, 51-75%, 76-100%) .

Western blotting provides an additional quantitative approach for TMEM237 protein detection in clinical samples where sufficient tissue is available. For all methodologies, inclusion of appropriate positive controls (known TMEM237-expressing tissues) and negative controls (antibody omission, isotype controls) is essential for result validation. The complementary use of these techniques provides comprehensive assessment of TMEM237 status in clinical specimens at both mRNA and protein levels.