TMEM70 Antibody

What is TMEM70 and why is it significant in research?

TMEM70 (Transmembrane Protein 70) belongs to the TMEM70 family and plays a crucial role in the biogenesis of mitochondrial ATP synthase. The significance of TMEM70 in research stems from its involvement in energy metabolism and mitochondrial function. Defects in TMEM70 are a known cause of mitochondrial encephalocardiomyopathy neonatal due to ATP synthase deficiency (MT-ATPSD), which has been identified as a pan-ethnic disorder. Research has established TMEM70 gene defects as the most common cause of nuclear-origin ATP synthase deficiency .

What is the molecular structure and cellular localization of TMEM70?

TMEM70 is an inner mitochondrial membrane protein with distinct structural features including a cleavable N-terminal mitochondrial targeting sequence, two transmembrane segments, and a C-terminal hydrophilic domain. The mature protein has a molecular weight of approximately 20.7 kDa, although it is calculated to be 29 kDa based on its 260 amino acid sequence. Cellular fractionation experiments have confirmed that TMEM70 is almost exclusively detected in the mitochondrial fraction. The protein is oriented in the inner membrane with the loop connecting its two transmembrane segments located in the intermembrane space, while the C-terminal hydrophilic domain faces the matrix side .

What types of TMEM70 antibodies are available for research?

Research-grade TMEM70 antibodies are available as polyclonal antibodies, such as the rabbit IgG polyclonal antibody (20388-1-AP). These antibodies are typically generated using TMEM70 fusion proteins or specific peptides as immunogens. For instance, some antibodies are produced using a mixture of peptides located upstream of the transmembrane segments and at the C-terminus of TMEM70. These antibodies are suitable for various applications including Western Blot (WB), Immunohistochemistry (IHC), and ELISA techniques .

What species reactivity can be expected with TMEM70 antibodies?

Most commercially available TMEM70 antibodies show tested reactivity with human and mouse samples. This cross-reactivity is likely due to the high conservation of TMEM70 protein sequence across mammalian species. When planning experiments, researchers should verify the specific reactivity of their chosen antibody with their species of interest. Published literature has demonstrated successful use of these antibodies in both human and mouse experimental systems .

What are the optimal protocols for using TMEM70 antibodies in Western Blot?

For Western Blot applications, TMEM70 antibodies should be used at dilutions ranging from 1:1000 to 1:4000. The protocol typically involves:

• Sample preparation: Total cellular extracts or mitochondrial fractions from relevant cell lines (e.g., A2780, Jurkat cells)

• Protein separation: SDS-PAGE using 10-12% gels

• Transfer: Standard wet or semi-dry transfer protocols

• Blocking: 5% non-fat milk or BSA in TBST for 1 hour at room temperature

• Primary antibody incubation: Anti-TMEM70 at recommended dilution (1:1000-1:4000) overnight at 4°C

• Washing: 3-5 washes with TBST

• Secondary antibody incubation: HRP-conjugated anti-rabbit IgG

• Detection: Enhanced chemiluminescence (ECL)

Researchers should expect to detect a band at approximately 18 kDa, which represents the mature form of TMEM70, despite its calculated molecular weight of 29 kDa .

How should TMEM70 antibodies be used for immunohistochemistry (IHC) applications?

For IHC applications, the following methodology is recommended:

• Sample preparation: Formalin-fixed, paraffin-embedded tissue sections (4-6 μm thickness)

• Antigen retrieval: TE buffer pH 9.0 is suggested (citrate buffer pH 6.0 can be used as an alternative)

• Blocking: 10% normal serum and 1% BSA in PBS for 1-2 hours

• Primary antibody incubation: TMEM70 antibody at 1:50-1:500 dilution overnight at 4°C

• Detection system: Appropriate secondary antibody and visualization reagents

Human liver tissue has been successfully used for positive control in IHC applications. The staining pattern should show punctate cytoplasmic distribution consistent with mitochondrial localization .

What cellular models are most appropriate for TMEM70 research?

Based on validated research, the following cellular models have proven effective for TMEM70 research:

These cell lines have demonstrated reliable TMEM70 expression levels and are amenable to genetic manipulation techniques including shRNA knockdown and CRISPR-Cas9 knockout strategies .

How can researchers effectively generate TMEM70 knockdown models?

To generate TMEM70 knockdown models, researchers have successfully employed shRNA-mediated silencing. The methodology includes:

• Selecting effective target sequences in TMEM70 mRNA (validated sequences include "GGGAAGGATATGTTCGATTCTTAAA" and "CGAGTCTGATTGGCCTTACATTTCT")

• Designing and cloning shRNAs into appropriate lentiviral vectors (such as pSIH-H1-copGFP-shRNA for constitutive knockdown or pLVTHM for inducible knockdown)

• Producing lentiviral particles and transducing target cells

• Selecting transduced cells using appropriate antibiotics (e.g., Puromycin)

• Validating knockdown efficiency by Western blot, with optimal reduction observed after 6-9 days of induction in inducible systems

Researchers should note that TMEM70 levels need to decrease below a certain threshold (approximately 10% of normal levels) before significant reduction in ATP synthase abundance is observed .

What is the methodology for generating TMEM70 knockout cell lines using CRISPR-Cas9?

For CRISPR-Cas9 mediated TMEM70 knockout, the following protocol has been validated:

• Design sgRNAs targeting early exons of TMEM70 (effective targets include exons 1 and 2)

• Clone sgRNAs into a lentiviral guide RNA expression vector (e.g., lentiGuide-Puro)

• Co-transfect cells with Cas9 expression vector (e.g., plentiCas9-Blast) and the sgRNA construct

• Select cells with appropriate antibiotics (Blasticidin 20 μg/ml and Puromycin 2 μg/ml) for approximately 3 days

• Allow cells to recover without antibiotics for 5 days

• Screen for TMEM70 knockout by Western blot

• Isolate single cell clones by limiting dilution

• Confirm genomic edits by PCR amplification and sequencing of the targeted region

This approach has successfully generated complete TMEM70 knockout cell lines with confirmable genomic alterations .

How can researchers analyze TMEM70-containing protein complexes?

To analyze TMEM70-containing protein complexes, two-dimensional blue native/SDS-PAGE (BN/SDS-PAGE) has proven effective:

• Solubilize mitochondrial membranes using digitonin (typically 4g/g protein ratio)

• Separate native complexes in the first dimension using 4-16% or 3-12% polyacrylamide gradient BN-PAGE

• Cut individual lanes and denature proteins using SDS

• Run second dimension SDS-PAGE

• Transfer to membranes for Western blot analysis using antibodies against TMEM70 and potential interacting partners (e.g., ATP synthase subunits)

This technique has revealed that TMEM70 does not associate with fully assembled ATP synthase but forms complexes of approximately 300-400 kDa that may contain unassembled ATP synthase subunit c. Additionally, TMEM70 forms dimers that are resistant to denaturing conditions .

How does TMEM70 deficiency affect ATP synthase assembly and function?

Research on TMEM70 knockdown and knockout models has established that:

• TMEM70 deficiency leads to decreased levels of assembled and functional ATP synthase (approximately 40-50% reduction)

• Multiple ATP synthase subunits from both F1 and Fo sectors show reduced abundance in TMEM70-deficient cells

• TMEM70 is not absolutely essential for ATP synthase assembly but enables higher enzyme yields required for life-compatible ATP synthesis rates

• In the absence of TMEM70, cells maintain a basal level of ATP synthase, suggesting the existence of TMEM70-independent assembly pathways

These findings indicate that TMEM70 functions as an assembly factor that enhances the efficiency of ATP synthase biogenesis rather than being strictly required for the process .

What is the proposed molecular mechanism of TMEM70 function in ATP synthase assembly?

Based on biochemical and structural studies, TMEM70 appears to function as a scaffold that facilitates the assembly of the c-ring of ATP synthase. The evidence for this model includes:

• TMEM70 interacts specifically with subunit c (Su.c) that is not yet incorporated into assembled ATP synthase

• TMEM70 forms dimers that associate into larger complexes of approximately 320 kDa

• The stoichiometry of these complexes is compatible with eight TMEM70 dimers interacting with up to eight Su.c subunits, matching the octameric structure of the c-ring

• Two-dimensional analysis reveals a series of discrete TMEM70-Su.c complexes with increasing Su.c content at higher molecular weights

• The transmembrane segments of TMEM70 are highly evolutionarily conserved, suggesting functional importance beyond membrane anchoring

According to this model, TMEM70 provides a scaffold that facilitates c-ring formation, and after the c-ring is incorporated into ATP synthase, the TMEM70 structure is released to accommodate newly imported Su.c subunits .

How should researchers interpret discrepancies between calculated and observed molecular weights of TMEM70?

Researchers frequently observe discrepancies between the calculated molecular weight of TMEM70 (29 kDa for the precursor, 260 amino acids) and its apparent molecular weight on SDS-PAGE (approximately 18 kDa). These discrepancies can be explained by:

• Post-translational processing: TMEM70 has a cleavable N-terminal mitochondrial targeting sequence, resulting in a mature protein of approximately 20.7 kDa

• Anomalous migration: Membrane proteins often migrate aberrantly on SDS-PAGE due to their hydrophobic nature and incomplete denaturation

• Post-translational modifications: Potential modifications may alter electrophoretic mobility

When validating antibody specificity, researchers should confirm the identity of the detected band through additional approaches such as demonstrating increased signal intensity in TMEM70-overexpressing cells and absence of signal in knockout models .

What are common troubleshooting strategies for weak or absent TMEM70 signal in Western blot?

When encountering weak or absent TMEM70 signals in Western blot experiments, consider the following strategies:

Additionally, researchers should ensure they are looking for the band at the correct molecular weight (approximately 18 kDa for mature TMEM70) and consider using positive control samples such as A2780 or Jurkat cell lysates .

How can researchers optimize immunohistochemistry protocols for TMEM70 antibodies?

For optimal IHC results with TMEM70 antibodies, consider these optimization strategies:

• Antigen retrieval: Compare TE buffer pH 9.0 (recommended) with citrate buffer pH 6.0 to determine which provides better epitope exposure

• Antibody titration: Test a range of dilutions (1:50, 1:100, 1:200, 1:500) to identify optimal signal-to-noise ratio

• Incubation conditions: Optimize time (overnight vs. 1-2 hours) and temperature (4°C vs. room temperature)

• Detection systems: Compare different detection methods (HRP vs. fluorescence-based)

• Counterstaining: Adjust intensity to provide context without obscuring specific staining

• Controls: Include positive controls (human liver tissue) and negative controls (primary antibody omission)

Researchers should expect a mitochondrial staining pattern characterized by punctate cytoplasmic distribution, with particularly strong signals in tissues with high mitochondrial content .

What are promising research areas for further understanding TMEM70 function?

Several promising research directions can advance our understanding of TMEM70:

• Structural biology approaches to determine the three-dimensional structure of TMEM70 and its complexes with ATP synthase subunits

• Investigation of tissue-specific roles of TMEM70 in different organ systems

• Comprehensive interactome analysis to identify additional TMEM70 binding partners beyond Su.c

• Exploration of potential regulatory mechanisms controlling TMEM70 expression and activity

• Development of therapeutic approaches targeting TMEM70 for mitochondrial disorders

• Comparative analysis of TMEM70 function across different species to identify evolutionarily conserved mechanisms

These directions could provide deeper insights into mitochondrial ATP synthase assembly and potentially reveal novel therapeutic targets for mitochondrial disorders .

How can TMEM70 research contribute to understanding mitochondrial disease mechanisms?

TMEM70 research offers several avenues for advancing our understanding of mitochondrial diseases:

• Using TMEM70-deficient models to study the pathophysiology of ATP synthase deficiency

• Identifying compensatory mechanisms that allow minimal ATP synthase assembly in the absence of TMEM70

• Developing biomarkers for early detection of TMEM70-related disorders

• Investigating potential genetic modifiers that influence disease severity in patients with TMEM70 mutations

• Testing therapeutic approaches aimed at enhancing ATP synthase assembly or function in TMEM70-deficient cells

• Understanding tissue-specific manifestations of TMEM70 deficiency to explain the clinical features of mitochondrial encephalocardiomyopathy

These studies could potentially lead to improved diagnostic and therapeutic strategies for patients with mitochondrial disorders caused by TMEM70 mutations or other defects in ATP synthase assembly .