tmem71 Antibody

Shipped with Ice Packs
In Stock

Description

Role in Glioma and Glioblastoma

  • Overexpression in Tumors: TMEM71 mRNA levels increase with glioma grade and are elevated in IDH-wild-type and MGMT-unmethylated gliomas .

  • Immune Modulation: TMEM71 correlates with immune checkpoints (PD-1, PD-L1, TIM-3) and inflammatory pathways (PI3K-AKT, JAK-STAT), suggesting its role in tumor immune evasion .

  • Prognostic Marker: High TMEM71 expression predicts shorter survival in glioma patients (HR = 1.9, p < 0.001) .

Immune Cell Infiltration

  • In glioma, TMEM71 expression is linked to macrophage and T-cell activation .

  • In NPC, TMEM71 levels influence naïve B-cell and plasma cell infiltration, impacting tumor microenvironment dynamics .

Functional Pathways and Therapeutic Implications

PathwayBiological ImpactDisease Context
NLRP3 InflammasomeInduces pyroptosis, inhibits tumor growthNPC
JAK-STAT SignalingPromotes chemoresistance and immune evasionGlioma
PI3K-AKT SignalingEnhances cell survival and migrationGlioma

Therapeutic Potential:

  • TMEM71 antibodies enable targeted inhibition of oncogenic pathways in glioma .

  • In NPC, TMEM71 overexpression could reactivate tumor-suppressive NLRP3 pathways .

Comparative Analysis of TMEM71 Antibody Applications

ApplicationPACO30646 16722-1-AP HPA058401
Western Blot✅ (33 kDa band)
IHC (Cancer Tissue)✅ (Gastric/colon cancer)✅ (Prostate cancer)✅ (Broad tissue array)
ELISA
Immune Cell Studies

Product Specs

Buffer
Preservative: 0.03% Proclin 300
Composition: 50% Glycerol, 0.01M PBS, pH 7.4
Form
Liquid
Lead Time
Made-to-order (14-16 weeks)
Synonyms
tmem71; si:ch211-235o23.1; Transmembrane protein 71
Target Names
tmem71
Uniprot No.

Target Background

Database Links
Protein Families
TMEM71 family
Subcellular Location
Membrane; Multi-pass membrane protein.

Q&A

What is TMEM71 and what are its main biological functions?

TMEM71 is a transmembrane protein that has been identified as a potential biomarker and therapeutic target in various cancer types. Research indicates it plays significant roles in immune and inflammatory responses, cell proliferation, cell migration, chemotaxis, and responses to drugs . TMEM71 has been linked to the inflammasome complex through analysis of Gene Ontology (GO) enrichment data . Notably, it appears to participate in immune-related signaling, with significant associations to immune checkpoint molecules like PD-1, PD-L1, TIM-3, and B7-H3 . TMEM71 interacts with the NLRP3/caspase-1/GSDMD pathway, which is integral to cellular pyroptosis (a form of inflammatory cell death) and tumor progression . The biological function of TMEM71 appears to be tissue-specific, with different expression patterns and effects observed across various cancer types.

How does TMEM71 expression differ between normal and cancerous tissues?

TMEM71 exhibits complex expression patterns that vary significantly between cancer types. In gliomas, TMEM71 mRNA levels increase with higher cancer grades, showing overexpression in IDH-wild-type and MGMT-unmethylated samples, as well as in mesenchymal subtype gliomas . High expression of TMEM71 in glioma correlates with shorter survival times, suggesting an oncogenic role in this context .

What is the subcellular localization of TMEM71 and how can it be detected?

As a transmembrane protein, TMEM71 primarily localizes to cellular membranes. Immunofluorescence staining has revealed co-localization of TMEM71 with NLRP3 in nasopharyngeal carcinoma tumor cells, suggesting potential functional interactions between these proteins . Detection of TMEM71 in tissue samples typically involves immunohistochemistry (IHC) or immunofluorescence (IF) techniques using specific antibodies.

For immunohistochemistry, sections are typically deparaffinized, rehydrated, and subjected to antigen retrieval using sodium citrate buffer (pH 6.0) . Primary antibody incubation is performed at dilutions around 1:50, followed by appropriate secondary antibody application and signal amplification . For immunofluorescence, similar sample preparation is used, with TMEM71 typically visualized using TRITC-conjugated secondary antibodies (red fluorescence), while counterstaining with DAPI identifies cell nuclei .

How can researchers investigate the seemingly contradictory roles of TMEM71 in different cancers?

The dual nature of TMEM71—functioning as an oncogene in glioma but as a tumor suppressor in NPC—presents a fascinating research challenge. To investigate these contradictory roles, researchers should implement several strategic approaches:

  • Comparative transcriptomic and proteomic profiling across multiple cancer types to identify tissue-specific binding partners and regulatory networks

  • Examination of post-translational modifications of TMEM71 that might differ between cancer types

  • Investigation of tissue-specific isoforms or splice variants

  • Analysis of the tumor microenvironment and its influence on TMEM71 function

  • Assessment of TMEM71's interaction with tissue-specific transcription factors or signaling pathways

The contrasting roles likely reflect the complex tumor biology where the same protein can function differently depending on the cellular context and genetic background. This is exemplified by TMEM71's positive correlation with immune responses in gliomas, while in breast cancer, reduced levels have been observed with studies showing its overexpression can inhibit cell proliferation and migration . Researchers should design experiments that specifically address these contextual differences, potentially using matched normal-tumor samples from the same patient to control for genetic background variables.

What is known about TMEM71's interaction with the NLRP3 inflammasome pathway?

TMEM71 has been identified as a key gene associated with the pyroptosis regulator NLRP3. While no studies had directly linked TMEM71 to NLRP3 before recent research, other members of the TMEM family have been shown to regulate pyroptosis by modulating intracellular calcium levels, promoting inflammasome formation, and activating caspase-1 .

Molecular docking analysis has revealed specific binding sites between TMEM71 and NLRP3, and this interaction has been confirmed through co-immunoprecipitation studies . Overexpression of TMEM71 in NPC cell lines activates the NLRP3/Caspase-1/GSDMD pathway, as demonstrated by increased expression of these proteins detected through qPCR and Western blot analyses .

Functionally, this activation correlates with reduced NPC cell viability, proliferation, and invasiveness, suggesting that TMEM71 inhibits NPC tumor growth by interacting with NLRP3 and activating pyroptosis pathways . Importantly, these anti-tumor effects were reversed upon transfection with si-NLRP3, confirming the mechanistic link between TMEM71's tumor-suppressive function and NLRP3 pathway activation .

How does TMEM71 expression influence immune cell infiltration in the tumor microenvironment?

TMEM71 expression has significant associations with immune cell infiltration patterns in the tumor microenvironment. Analysis using single-sample Gene Set Enrichment Analysis (ssGSEA) revealed that TMEM71 expression in NPC correlates positively with B-cell infiltration . This finding aligns with previous research indicating that higher B-cell density correlates with improved NPC prognosis .

Interestingly, despite established tumor-suppressive roles for M1 macrophages and dendritic cells in NPC, analysis revealed a negative correlation between TMEM71 expression and these immune cells . This unexpected finding highlights the complex and heterogeneous nature of immune responses in cancer and suggests that TMEM71 may regulate immune cell infiltration through multiple mechanisms.

The relationship between TMEM71 and immune cells extends to immune checkpoint molecules, as TMEM71 expression has been tightly associated with PD-1, PD-L1, TIM-3, and B7-H3 in glioma research . This suggests potential implications for immunotherapy responses and provides additional research directions for investigating TMEM71's role in modulating anti-tumor immunity.

What are the optimal protocols for TMEM71 antibody-based immunohistochemistry?

Based on published research protocols, the following methodology has proven effective for TMEM71 immunohistochemistry:

Sample preparation:

  • Cut 4 μm sections from paraffin-embedded samples

  • Deparaffinize with xylene

  • Rehydrate through a graded ethanol series

Antigen retrieval:

  • Microwave sections in sodium citrate buffer (pH 6.0) for 10 minutes

  • Cool to room temperature

Immunostaining:

  • Block with 5% goat serum for 30 minutes at room temperature

  • Apply primary TMEM71 antibody at 1:50 dilution (Abcam)

  • Incubate overnight at 4°C

  • Wash three times with PBS (5 minutes each)

  • Apply HRP-conjugated goat anti-rabbit secondary antibody (1:200 dilution)

  • Incubate at room temperature for 1 hour

  • Perform signal amplification using an SP staining kit

  • Mount and seal sections

Scoring:
Score staining intensity from 0 (no staining) to 12 (strong positive), based on both the proportion and intensity of stained cells .

This protocol has been successfully used in clinical studies involving 421 NPC patients, validating its reliability for TMEM71 detection in tissue samples .

How can researchers optimize immunofluorescence protocols for TMEM71 co-localization studies?

For investigating TMEM71 co-localization with other proteins like NLRP3, the following immunofluorescence protocol has been validated:

Sample preparation:

  • Deparaffinize and perform antigen retrieval as in IHC protocol

  • Block with 5% Bovine Serum Albumin (BSA) or normal goat serum at room temperature for 1 hour

Multi-protein staining:

  • Incubate with primary antibodies overnight at 4°C:

    • TMEM71 (1:100, Abcam)

    • NLRP3 (1:100, Abcam)

    • Other markers of interest (e.g., CK5/6 at 1:100)

  • Apply corresponding secondary antibodies (1 hour at room temperature):

    • For TMEM71: TRITC-conjugated secondary antibody (1:500, Abcam) - red fluorescence

    • For NLRP3: Alexa Fluor 488 FITC-conjugated secondary antibody (1:500, Abcam) - green fluorescence

    • For other markers: Appropriate fluorophore-conjugated antibodies

  • Counterstain with DAPI (1:5000, Abcam) for 5 minutes to label nuclei

  • Wash with PBS three times (5 minutes each)

  • Mount with anti-fluorescence quenching mounting medium

  • Store slides in the dark

Imaging:
Capture images using a fluorescence microscope (e.g., Olympus FV1000), taking at least three images per slide to document fluorescence signals and co-localization patterns .

This approach allows visualization of protein co-localization through overlapping fluorescence signals, providing insights into potential protein-protein interactions within cellular compartments.

What plasmids and primers are recommended for TMEM71 overexpression and knockdown studies?

For researchers conducting functional studies involving TMEM71 manipulation, the following validated plasmids and primers have been successfully used:

Table: Recommended Plasmids and Primers for TMEM71 Research

Name of plasmid or primerSequences (5′–3′)
OE-TMEM71 plasmid (F)TACCGAGCTCGGATCCGCCACCATGTACCGAATATCTCAAC
OE-TMEM71 plasmid (R)GATATCTGCAGAATTCTCAAATTTTGACAAACCGAG
si-NLRP3 (siRNA)AGAACTAGTTGACTATATA
si-NC plasmid (siRNA)GCGCGCTTTGTAGGATTCG
TMEM71-FACTCATTTATACCAGGAAACAGACA
TMEM71-RTGTCTGTTTCCTGGTATAAATGAGT
NLRP3-FCCAGAACCTGCTGTCTTGTG
NLRP3-RAGAAGGGGTAGCAGTGGTCA
Caspase-1-FCCTCGCCTTTGCCGATCC
Caspase-1-RGGATCTTCATGAGGTAGTCAGTC
GSDMD-FGCCTCCACAACTTCCTGACAGATG
GSDMD-RGGTCTCCACCTCTGCCCGTAG
β-actin-FGGAGATTACTGCCCTGGCTCCTA
β-actin-RGACTCATCGTAC TCCTGCTTGCTG

Transfection can be performed using Lipo8000™ transfection reagent (Shanghai Beyotime Co.) according to the manufacturer's protocol . For experimental designs, researchers typically establish control groups (NC, empty vector) alongside TMEM71 overexpression groups, with additional conditions for pathway validation (e.g., OE-TMEM71 + si-NLRP3) .

How should researchers interpret TMEM71 staining results in clinical samples?

Interpretation of TMEM71 staining in clinical samples should follow a systematic approach:

  • Staining intensity assessment: Score from 0 (no staining) to 12 (strong positive) based on both the proportion and intensity of stained cells.

  • Positive vs. negative determination: In clinical studies, samples are often categorized as "TMEM71-positive" or "TMEM71-negative" based on predetermined threshold scores.

  • Subcellular localization analysis: As a transmembrane protein, TMEM71 should primarily show membrane localization, though cytoplasmic staining may also be observed.

  • Correlation with clinical parameters: Analyze TMEM71 expression in relation to:

    • Tumor stage and grade

    • Histological subtype

    • Patient demographic information

    • Treatment response

    • Survival outcomes

  • Statistical validation: Use appropriate statistical methods to validate findings:

    • Kaplan-Meier survival analysis for prognostic value

    • Multivariate Cox regression to assess independent prognostic significance

    • ROC analysis to evaluate diagnostic utility (AUC values)

What methods are recommended for investigating TMEM71's relationship with the NLRP3 pathway?

To effectively investigate TMEM71's relationship with the NLRP3 pathway, researchers should employ a multi-faceted approach:

  • In silico analysis:

    • Molecular docking to predict binding sites between TMEM71 and NLRP3

    • Protein-protein interaction network analysis

  • Physical interaction verification:

    • Co-immunoprecipitation using TMEM71 and NLRP3 antibodies

    • Proximity ligation assays to confirm in situ interactions

  • Co-localization studies:

    • Multiplex immunofluorescence with TMEM71 and NLRP3 antibodies

    • Confocal microscopy for high-resolution visualization

  • Functional validation:

    • Overexpression of TMEM71 followed by assessment of NLRP3 pathway activation

    • siRNA knockdown of NLRP3 to determine if TMEM71 effects are NLRP3-dependent

    • Measurement of downstream effectors (Caspase-1, GSDMD) at both mRNA and protein levels

  • Phenotypic assessment:

    • Cell viability assays (e.g., CCK-8)

    • Colony formation assays

    • Cell invasion assays

    • Assessment of pyroptosis markers

This comprehensive approach has successfully demonstrated that TMEM71 inhibits NPC tumor growth by interacting with NLRP3 and activating the NLRP3/Caspase-1/GSDMD pathway, with these effects being reversible upon NLRP3 knockdown .

How can researchers reconcile contradictory findings about TMEM71 function across different cancer types?

The apparent contradictory roles of TMEM71 across different cancer types (oncogenic in glioma vs. tumor-suppressive in NPC) represent a common challenge in cancer biology that requires systematic investigation:

  • Tissue-specific context evaluation:

    • Analyze the predominant signaling pathways in each tissue type

    • Identify tissue-specific binding partners that may direct TMEM71 function

    • Examine differences in genetic landscapes (e.g., common mutations in each cancer type)

  • Isoform and mutation analysis:

    • Sequence TMEM71 in different cancer types to identify potential mutations

    • Investigate expression of different TMEM71 isoforms or splice variants

    • Assess potential post-translational modifications

  • Tumor microenvironment consideration:

    • Evaluate immune cell infiltration patterns associated with TMEM71 in each cancer

    • Analyze the inflammatory milieu that may influence TMEM71 function

    • Assess tumor hypoxia status and its impact on TMEM71 activity

  • Pathway activation profiling:

    • Determine whether TMEM71 activates the same downstream pathways in different cancers

    • Investigate potential dual roles in the same pathway dependent on cellular context

    • Explore alternative signaling routes in different cancer types

  • Developmental origin consideration:

    • Consider the embryonic origin of different tissues and how this might influence protein function

    • Assess normal TMEM71 function in the tissue of origin

This systematic approach acknowledges that protein function is highly context-dependent in cancer biology, with the same protein potentially exhibiting opposing functions based on cellular context, genetic background, microenvironment, and activation state of other signaling pathways.

What are the emerging applications of TMEM71 antibodies in cancer research?

TMEM71 antibodies are finding increasing applications in cancer research, with several promising directions:

  • Biomarker development: TMEM71 shows potential as a diagnostic and prognostic biomarker across multiple cancer types. In NPC, TMEM71 detection by immunohistochemistry demonstrated significant prognostic value with an AUC of 0.941 in the GSE64634 dataset and 1.000 in the GSE53819 dataset . This high diagnostic accuracy positions TMEM71 as a candidate for clinical diagnostic applications.

  • Therapeutic target validation: Research indicates that TMEM71 modulates cancer cell behaviors through interaction with the NLRP3/Caspase-1/GSDMD pathway . Antibodies against TMEM71 could be used to validate its potential as a therapeutic target, particularly in cancers where it functions as an oncogene.

  • Immunotherapy response prediction: Given TMEM71's association with immune checkpoint molecules (PD-1, PD-L1, TIM-3, and B7-H3) and immune cell infiltration patterns , TMEM71 antibodies may help identify patients likely to respond to immunotherapy.

  • Cancer stem cell research: TMEM71 is highly expressed in glioma stem cells , suggesting potential applications in targeting cancer stem cell populations, which are often responsible for treatment resistance and recurrence.

  • Chemoresistance mechanism studies: TMEM71's elevated expression in temozolomide-resistant cells indicates its potential role in chemoresistance mechanisms, making it a valuable target for studying and potentially overcoming treatment resistance.

How can TMEM71 antibodies contribute to understanding the role of pyroptosis in cancer?

TMEM71 antibodies offer valuable tools for investigating pyroptosis in cancer through several approaches:

  • Mapping pyroptosis pathway activation: TMEM71 antibodies can help visualize and quantify the activation of pyroptosis pathways by detecting co-localization with NLRP3 and measuring downstream effectors like cleaved Caspase-1 and GSDMD.

  • Identifying cell populations undergoing pyroptosis: Using TMEM71 antibodies in conjunction with pyroptosis markers enables identification of specific cell populations undergoing this inflammatory cell death process within the heterogeneous tumor microenvironment.

  • Monitoring treatment responses: Changes in TMEM71 expression and localization following treatment with chemotherapeutics or immunotherapies may provide insights into how these treatments induce or inhibit pyroptosis.

  • Investigating immune consequences of pyroptosis: TMEM71 antibodies can help correlate pyroptosis activation with changes in the tumor immune microenvironment, including immune cell recruitment and activation patterns.

  • Therapeutic induction of pyroptosis: In cancers where TMEM71 acts as a tumor suppressor by activating pyroptosis (e.g., NPC), antibodies can help validate approaches to enhance this pathway for therapeutic benefit.

The relationship between TMEM71 and pyroptosis represents an emerging area of cancer biology with potential implications for both understanding disease progression and developing novel therapeutic strategies.

Quick Inquiry

Personal Email Detected
Please use an institutional or corporate email address for inquiries. Personal email accounts ( such as Gmail, Yahoo, and Outlook) are not accepted. *
© Copyright 2025 TheBiotek. All Rights Reserved.