sedl-1 Antibody

Shipped with Ice Packs
In Stock

Description

Biological Context of SEDL

The SEDL gene (OMIM: 300202) encodes a 140-amino-acid protein involved in endoplasmic reticulum (ER)-to-Golgi vesicular transport. Mutations in SEDL disrupt protein trafficking, leading to skeletal dysplasia . Research antibodies targeting SEDL are critical for:

  • Detecting SEDL protein expression in cellular models

  • Studying pathogenic mutations in SEDT

  • Investigating intracellular protein trafficking mechanisms

Key Antibody Characteristics

PropertyDetails
Target EpitopeSEDL protein (amino acids 1–140)
ApplicationsImmunoblotting, immunofluorescence, somatic-cell hybrid analysis
Cross-ReactivityDemonstrated in mouse/human hybrid models
ClonalityPolyclonal (commonly used in research settings)

Research Findings

  • Mutation Detection: Antibodies against SEDL have identified recurrent RNA-splicing mutations (e.g., IVS3-10_12del) in 71% of SEDT cases, confirming its X-linked inheritance .

  • Cellular Localization: SEDL antibodies localize the protein to the ER-Golgi intermediate compartment, consistent with its role in vesicular transport .

  • Functional Studies: Loss of SEDL disrupts collagen secretion in chondrocytes, contributing to skeletal defects .

Primer Sequences for SEDL Analysis

Primer NameSequence (5’→3’)Purpose
5′21FAGGAGCCATATATTGAAGACCATGGenomic PCR amplification
3′52RTCCTGAGTATACACCATTGTGGRT-PCR and sequencing

Cross-Species Reactivity

  • SEDL antibodies exhibit cross-reactivity between murine and human orthologs due to 57% protein sequence homology .

  • Validated in human epididymal tissue, sperm, and breast milk .

Related Antibodies and Potential Confounds

While "SEDL-1 Antibody" specifically targets the SEDL protein, similar nomenclature (e.g., "SEDI Antibody") may refer to unrelated targets:

Antibody NameTargetResearch Context
SEDL-1 AntibodySEDL proteinSEDT, ER-Golgi transport
SEDI Antibody (SPC-206)SOD1 EDIALS, SOD1 misfolding

Note: StressMarq’s SEDI Antibody (SPC-206) targets superoxide dismutase 1 (SOD1), not SEDL, and is used in amyotrophic lateral sclerosis (ALS) research .

Future Directions

Current gaps include therapeutic antibody development for SEDT and high-resolution structural studies of SEDL-antibody complexes. Advances in cryo-EM may elucidate how SEDL mutations alter protein interactions in skeletal dysplasia .

Product Specs

Buffer
Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M Phosphate Buffered Saline (PBS), pH 7.4
Form
Liquid
Lead Time
Made-to-order (14-16 weeks)
Synonyms
sedl-1 antibody; W05H7.3 antibody; Probable trafficking protein particle complex subunit 2 antibody
Target Names
sedl-1
Uniprot No.

Target Background

Function
This antibody is believed to play a role in the transport of vesicles from the endoplasmic reticulum to the Golgi apparatus. It is essential for the systemic distribution of the RNA interference (RNAi) response.
Database Links

KEGG: cel:CELE_W05H7.3

STRING: 6239.W05H7.3

UniGene: Cel.19794

Protein Families
TRAPP small subunits family, Sedlin subfamily
Subcellular Location
Cytoplasm, perinuclear region. Endoplasmic reticulum. Golgi apparatus.

Quick Inquiry

Personal Email Detected
Please use an institutional or corporate email address for inquiries. Personal email accounts ( such as Gmail, Yahoo, and Outlook) are not accepted. *
© Copyright 2025 TheBiotek. All Rights Reserved.