The SEDL gene (OMIM: 300202) encodes a 140-amino-acid protein involved in endoplasmic reticulum (ER)-to-Golgi vesicular transport. Mutations in SEDL disrupt protein trafficking, leading to skeletal dysplasia . Research antibodies targeting SEDL are critical for:
Detecting SEDL protein expression in cellular models
Investigating intracellular protein trafficking mechanisms
Mutation Detection: Antibodies against SEDL have identified recurrent RNA-splicing mutations (e.g., IVS3-10_12del) in 71% of SEDT cases, confirming its X-linked inheritance .
Cellular Localization: SEDL antibodies localize the protein to the ER-Golgi intermediate compartment, consistent with its role in vesicular transport .
Functional Studies: Loss of SEDL disrupts collagen secretion in chondrocytes, contributing to skeletal defects .
| Primer Name | Sequence (5’→3’) | Purpose |
|---|---|---|
| 5′21F | AGGAGCCATATATTGAAGACCATG | Genomic PCR amplification |
| 3′52R | TCCTGAGTATACACCATTGTGG | RT-PCR and sequencing |
SEDL antibodies exhibit cross-reactivity between murine and human orthologs due to 57% protein sequence homology .
Validated in human epididymal tissue, sperm, and breast milk .
While "SEDL-1 Antibody" specifically targets the SEDL protein, similar nomenclature (e.g., "SEDI Antibody") may refer to unrelated targets:
| Antibody Name | Target | Research Context |
|---|---|---|
| SEDL-1 Antibody | SEDL protein | SEDT, ER-Golgi transport |
| SEDI Antibody (SPC-206) | SOD1 EDI | ALS, SOD1 misfolding |
Note: StressMarq’s SEDI Antibody (SPC-206) targets superoxide dismutase 1 (SOD1), not SEDL, and is used in amyotrophic lateral sclerosis (ALS) research .
Current gaps include therapeutic antibody development for SEDT and high-resolution structural studies of SEDL-antibody complexes. Advances in cryo-EM may elucidate how SEDL mutations alter protein interactions in skeletal dysplasia .