TPSAB1 Human
Description
Biological Function
TPSAB1 is the major neutral protease in mast cells, released during degranulation. Its enzymatic activity is heparin-dependent and inhibitor-resistant, distinguishing it from other proteases . Key roles include:
-
Allergic Responses: Mediates tissue remodeling and inflammation in asthma and anaphylaxis .
-
Isoform Specificity: Encodes alpha-1 (basophil-predominant) and beta-1 (mast cell-predominant) tryptases .
Genetic and Clinical Associations
Hereditary alpha-tryptasemia (HαT), caused by TPSAB1 copy number variations (CNVs), is linked to elevated basal serum tryptase (BST) and mast cell disorders.
Genetic Criteria for HαT Diagnosis
| Condition | TPSAB1 Copies | TPSB2 Copies |
|---|---|---|
| HαT (≥2 copies) | ≥2 | ≥3 |
| HαT with TPSB2 amplification | ≥3 | ≥2 |
| Combined CNV | ≥2 + ≥3 |
Clinical Prevalence
| Population | HαT Prevalence |
|---|---|
| Healthy donors | 4% |
| Non-clonal MCAS patients | 29% |
| Mastocytosis patients | 18% |
Hereditary alpha-tryptasemia (HαT)
-
Mechanism: Increased TPSAB1 gene dose elevates BST levels, correlating with mRNA expression .
-
Symptoms: Often asymptomatic but associated with recurrent anaphylaxis, Ehlers-Danlos syndrome, and irritable bowel syndrome .
-
Diagnostic Challenges: HαT must be differentiated from clonal mast cell disorders (e.g., systemic mastocytosis) .
Mast Cell Disorders
| Disorder | TPSAB1 CNV Frequency |
|---|---|
| Mastocytosis (KIT^D816V^) | 21% (MC-restricted) |
| Mastocytosis (multilineage) | 10% |
| Non-clonal MCAS | 29% |
Recombinant Protein Use
Diagnostic Tools
Product Specs
Q&A
What is TPSAB1 and what proteins does it encode?
TPSAB1 is a gene located on chromosome 16p13.3 that encodes tryptase proteins, primarily α-tryptase and β-tryptase isoforms. Approximately two-thirds of humans have α-tryptase encoded at TPSAB1 on one or both alleles, while everyone has β-tryptase encoded at one or both TPSB2 alleles, as well as at non–α-tryptase–encoding TPSAB1 loci . These serine proteases play critical roles in innate immunity and inflammatory processes.
The tryptase isoforms demonstrate distinct substrate specificities. For example, isoform 2 cleaves large substrates such as fibronectin more efficiently than isoform 1, while showing reduced efficiency toward smaller substrates . This differential activity is important for understanding the functional consequences of TPSAB1 variations in different physiological and pathological contexts.
What is hereditary alpha-tryptasemia (HαT) and how is it related to TPSAB1?
Hereditary alpha-tryptasemia (HαT) is an autosomal dominant genetic condition characterized by replications of the α-tryptase encoding sequence in the TPSAB1 gene. These gene duplications lead to elevated basal serum tryptase (BST) levels, typically two- to threefold higher than median levels in individuals without HαT .
HαT is inherited in an autosomal dominant pattern, with no reported de novo replications . The extra copies of TPSAB1 are present within the tryptase locus at chromosome 16p13.3. Through cloning, long-read sequencing, and assembly of the human tryptase locus, researchers have confirmed that these replicated sequences encode canonical α-tryptase protein, but with unique proximal noncoding variants that distinguish duplicated α-tryptase (αDUP) from wild-type α-tryptase (αWT) sequences .
How prevalent is TPSAB1 gene replication in different populations?
In a comprehensive study conducted by the Spanish Network on Mastocytosis (REMA) involving 959 subjects, the distribution of HαT was as follows:
| Population Group | HαT Prevalence | Percentage |
|---|---|---|
| Healthy donors (n=346) | 15 | 4% |
| Non-clonal MCAS patients (n=149) | 43 | 29% |
| Mastocytosis patients (n=464) | 84 | 18% |
Among mastocytosis patients, HαT was more frequently observed in those with mast cell-restricted KIT^D816V mutation (21%) compared to those with multilineage KIT^D816V (10%), representing a statistically significant difference (p = 0.008) .
How does TPSAB1 copy number variation affect basal serum tryptase levels?
TPSAB1 copy number variation shows a direct linear relationship with basal serum tryptase (BST) levels. Research has demonstrated that BST elevations in individuals with HαT arise from the overexpression of replicated TPSAB1 loci encoding canonical α-tryptase protein, compounded by coinheritance of a linked overactive promoter element .
This understanding has led to data-driven modeling that can predict BST levels based on TPSAB1 replication number. Researchers analyzed data from 204 individuals with normal TPSAB1 copy number and 309 individuals with HαT (without clinical evidence of clonal mast cell disease) to generate prediction intervals with upper limits for predicted BST levels based on TPSAB1 replication number .
This model redefines clinically meaningful upper reference limits for BST, establishing 11.4 ng/mL as the upper limit for individuals without HαT. For those with HαT, personalized upper limits can be calculated based on the individual's TPSAB1 replication number .
What methods are used to determine TPSAB1 genotype?
Several molecular approaches are employed for TPSAB1 genotyping, each with specific advantages for research and clinical applications:
-
PCR amplification with specialized primers: Researchers use primers designed on conserved sequences present in all identified α- and β-tryptase sequences. For example: forward primer (GGGCAAGTCCACAGGGAGCT) and reverse primer (CTGGGGAGCAAGGAGGAGCA) to amplify sequences between the ATG start site and conserved regions .
-
Cloning and sequencing workflow:
-
Digital Droplet PCR assay: Recently validated single-well multiplex digital droplet PCR assays provide enhanced accuracy for quantifying TPSAB1 copy numbers, especially important for clinical applications .
These methods must overcome significant challenges in TPSAB1 genotyping, including high sequence similarity (98-99% between β-tryptase isoforms, and 93% similarity between α-tryptases and β-tryptases) and the susceptibility of the genomic region to breakage and recombination .
What are the structural characteristics of TPSAB1 gene replications in HαT?
Research involving cloning, long-read sequencing, and assembly of the human tryptase locus has revealed important structural characteristics of TPSAB1 gene replications in HαT:
-
Canonical protein structure: Replicated TPSAB1 sequences encode canonical α-tryptase protein, confirming that the functional impact is not due to novel protein variants .
-
Unique noncoding variants: Duplicated α-tryptase (αDUP) can be distinguished from wild-type α-tryptase (αWT) by a series of unique proximal noncoding variants .
-
Expanded 5' UTR motif: A key finding is an expanded DNA motif within the 5' untranslated region (UTR) that is linked to TPSAB1 replication-associated variants. When cloned and tested, this expanded motif demonstrated increased in vitro promoter activity compared to the paralogous region in the non-replicated promoter .
-
Enhanced transcriptional activity: In vitro and in silico analyses of RNA sequences confirmed the relative overexpression of αDUP-tryptase sequences in primary basophils, cultured mast cells, and various RNA sequence datasets .
These structural characteristics explain why BST elevations in individuals with HαT are disproportionate to the increase in TPSAB1 copy number - the replicated genes have inherently higher transcriptional activity due to the associated promoter variants.
How do TPSAB1 replications affect mast cell disease diagnosis and clinical management?
TPSAB1 replications significantly impact the diagnosis and management of mast cell diseases through several mechanisms:
-
Diagnostic confusion: HαT and systemic mastocytosis (SM) can present with similar symptoms, and elevated BST due to HαT may be mistaken for the minor diagnostic SM criterion of elevated tryptase .
-
Redefined reference ranges: Research has established that for individuals without HαT, the upper limit of normal BST should be 11.4 ng/mL (rather than the commonly used 20 ng/mL) when considering the diagnosis of clonal mast cell disease .
-
Personalized clinical thresholds: For individuals with HαT, individualized upper limits can be calculated based on TPSAB1 replication number, helping determine which patients should undergo more extensive workup including bone marrow aspiration and biopsy .
-
Disease modification: HαT acts as a "hidden modifier" of many morbidities, including mast cell disorders. The co-presence of HαT may explain some of the variability in patient-perceived disease burden across different SM subtypes .
-
Anaphylaxis risk modulation: SM patients with Hymenoptera venom allergy (HVA) are already at high risk for potentially fatal anaphylaxis from wasp stings, and the coexistence of HαT may further increase HVA severity .
These findings emphasize the importance of TPSAB1 genotyping in the clinical evaluation of patients with suspected or confirmed mast cell disorders to ensure accurate diagnosis and appropriate management.
What are the challenges in TPSAB1 genotyping due to sequence homology?
TPSAB1 genotyping presents significant technical challenges due to the complex genomic architecture of the tryptase locus:
-
Extreme sequence similarity: The genomic region contains repetitive sequences with sequence similarity of up to 98% across at least 5 kilobases. β-tryptase sequences show 98-99% similarity between isoforms, and α-tryptases are approximately 93% identical to β-tryptases .
-
Recombination susceptibility: The tryptase locus is exceptionally susceptible to breakage and recombination, complicating the analysis of copy number variations .
-
Complex allelic structure: The tryptase locus displays significant structural complexity with various combinations of α-tryptase and β-tryptase encoding alleles, plus additional copy number gains and losses .
-
Primer design limitations: The high sequence conservation restricts the ability to design primers that can reliably distinguish between the various tryptase isoforms .
These challenges necessitate sophisticated molecular approaches and careful experimental design to accurately quantify TPSAB1 α-tryptase and β-tryptase copy numbers, particularly in clinical settings where accurate genotyping is essential for appropriate patient management.
How can TPSAB1 genotyping be used to establish personalized reference ranges for tryptase levels?
TPSAB1 genotyping enables a precision medicine approach to interpreting tryptase levels through the following methodology:
-
Data-driven modeling: Researchers developed a predictive model using data from 204 individuals with normal TPSAB1 copy number and 309 individuals with HαT (without clinical evidence of clonal mast cell disease) to generate prediction intervals with upper limits for BST levels based on TPSAB1 replication number .
-
Computational implementation: This model was implemented as an online application called "BST CALCULATER" (Basal Serum Tryptase Clinical cut-off Assigned by Locus Copy number of UTR-Linked element and Associated TPSAB1 Encoded Replication) available at https://bst-calculater.niaid.nih.gov/ .
-
Clinical threshold determination: The model establishes:
-
For individuals without HαT: an upper limit of 11.4 ng/mL
-
For individuals with HαT: personalized upper limits based on TPSAB1 replication number
-
-
Validation for clinical decision-making: The model was tested on patients with confirmed mast cell disease to validate its clinical utility. Ten individuals had BST levels below the 99.5% upper prediction limit based on their TPSAB1 replication number, but most had other clinical indications for bone marrow evaluation .
This approach represents a novel application of genotypic information to determine clinical reference ranges in a personalized manner, something that has not previously been used in laboratory medicine but is expected to expand as next-generation sequencing becomes more widely utilized in clinical practice .
What is the relationship between TPSAB1 genotype and clinical phenotypes in mast cell disorders?
The relationship between TPSAB1 genotype and clinical phenotypes in mast cell disorders reveals important patterns:
-
Differential prevalence: HαT was detected in 4% of healthy donors versus 29% of non-clonal mast cell activation syndrome (MCAS) patients and 18% of mastocytosis cases .
-
Mutation interaction: Among mastocytosis patients, HαT was more frequently found in those with mast cell-restricted KIT^D816V (21%) compared to those with multilineage KIT^D816V (10%), suggesting potential genetic interactions .
-
Tryptase elevation patterns: Median BST was higher in cases presenting with HαT (28.9 vs. 24.5 ng/mL), though no significant differences in BST were observed among HαT+ mastocytosis patients depending on the number of TPSAB1 replications .
-
Symptom modulation: HαT can alter the clinical presentation and symptom burden of systemic mastocytosis. The variability in patient-perceived disease burden across different SM subtypes, not well reflected in laboratory parameters, may partly be explained by the co-presence of HαT .
-
Clinical mimicry: HαT is associated with various multisystem manifestations that may mimic other conditions. For instance, gastrointestinal symptoms may be misdiagnosed as irritable bowel syndrome, connective tissue symptoms such as hypermobile joints may be interpreted as Ehlers-Danlos syndrome, and cardiovascular symptoms may be diagnosed as postural orthostatic tachycardia syndrome .
These findings underscore the importance of evaluating TPSAB1 genotype when assessing patients with suspected or confirmed mast cell disorders to better understand their clinical presentation and optimize management approaches.
How does the presence of HαT impact diagnostic criteria for systemic mastocytosis?
The presence of HαT significantly impacts the application and interpretation of diagnostic criteria for systemic mastocytosis (SM) in several ways:
-
Minor criterion complication: Elevated BST (>20 ng/mL) is a minor criterion for SM diagnosis. HαT can cause elevated BST independent of mast cell disorders, potentially leading to misdiagnosis if TPSAB1 genotyping is not performed .
-
Revised BST threshold: Research has established that for individuals without HαT, the clinically meaningful upper limit for BST should be 11.4 ng/mL (rather than 20 ng/mL) when considering the diagnosis of clonal mast cell disease .
-
Genotype-informed criteria: When applying individualized upper prediction limits based on TPSAB1 replication number as a minor criterion for SM diagnosis (instead of the standard >20 ng/mL threshold), research found that only one patient with the rare phenotype of well-differentiated ISM would no longer have met clinical criteria for their diagnosis .
-
Workup guidance: The genotype-informed reference ranges help establish robust thresholds for determining which patients should undergo more extensive evaluation, including bone marrow aspiration and biopsy, regardless of clinical presentation or symptomatology .
-
Diagnostic efficiency: Using TPSAB1 genotyping to establish personalized reference ranges can reduce unnecessary invasive procedures for individuals with HαT while ensuring appropriate evaluation for those with truly pathological tryptase elevations .
This genotype-informed approach to interpreting diagnostic criteria represents an important advance in the precision diagnosis of mast cell disorders, allowing more accurate classification and appropriate management.
What experimental approaches are used to study TPSAB1 expression and function?
Researchers employ several sophisticated experimental approaches to investigate TPSAB1 expression and function:
-
Genomic structural analysis:
-
Transcriptional analysis:
-
Molecular cloning techniques:
-
Copy number quantification:
-
Protein quantification:
-
Statistical modeling:
These complementary approaches allow researchers to overcome the technical challenges of studying this complex genomic region and to develop a comprehensive understanding of how TPSAB1 variations affect gene expression, protein function, and clinical phenotypes.
What is the significance of promoter variants associated with TPSAB1 replication?
Promoter variants associated with TPSAB1 replication have significant functional implications:
-
Distinctive noncoding signature: Research has identified unique proximal noncoding variants that distinguish duplicated α-tryptase (αDUP) from wild-type α-tryptase (αWT) sequences .
-
5' UTR expanded motif: A key finding is an expanded DNA motif within the 5' untranslated region (UTR) that is linked to TPSAB1 replication-associated variants .
-
Enhanced transcriptional activity: When cloned and tested, this expanded motif demonstrated increased in vitro promoter activity compared to the paralogous region in the non-replicated promoter .
-
Disproportionate expression effect: These promoter variants explain why BST elevations in individuals with HαT are disproportionate to the increase in TPSAB1 copy number - the replicated genes have inherently higher transcriptional activity .
-
Mechanistic explanation: In vitro and in silico analyses of RNA sequences confirmed the relative overexpression of αDUP-tryptase sequences in primary basophils, cultured mast cells, and various RNA sequence datasets, providing experimental validation of this mechanism .
Understanding these promoter variants has been crucial for developing accurate predictive models of BST levels based on TPSAB1 replication number, as the relationship is not simply based on gene dosage but is modified by the enhanced transcriptional activity associated with the replicated loci.
Product Science Overview
Tryptase alpha/beta-1 is a trypsin-like serine protease. The enzyme is stored in the secretory granules of mast cells in an inactive form and is released upon the activation and degranulation of these cells . When released, it forms active tetramers stabilized by heparin proteoglycan . This unique tetrameric structure makes the enzyme resistant to all known endogenous proteinase inhibitors .
The enzyme’s active sites are arranged in such a way that they face a narrow central pore, which contributes to its resistance to inhibition . This structural arrangement is essential for its function in the extracellular matrix, where it participates in various physiological and pathological processes.
Tryptase alpha/beta-1 is involved in several critical biological processes, including:
- Inflammation: It plays a significant role in the inflammatory response by breaking down extracellular matrix components and activating other proteases .
- Allergic Reactions: The enzyme is a mediator in the pathogenesis of asthma and other allergic disorders. It contributes to the symptoms of these conditions by promoting the release of histamine and other inflammatory mediators from mast cells .
- Tissue Remodeling: Tryptase alpha/beta-1 is involved in tissue remodeling and repair by degrading extracellular matrix proteins and facilitating cell migration .
Recombinant human tryptase alpha/beta-1 is produced using advanced biotechnological methods. The enzyme is typically expressed in a mouse myeloma cell line (NS0) and purified to high levels of purity (>95%) using techniques such as SDS-PAGE under reducing conditions . The recombinant form is often tagged with a C-terminal 10-His tag to facilitate purification and detection .
The recombinant enzyme is supplied as a carrier-free formulation, which means it does not contain bovine serum albumin (BSA). This formulation is particularly useful for applications where the presence of BSA could interfere with experimental results .
