TRIM17 Antibody

Shipped with Ice Packs
In Stock

Description

Overview of TRIM17 Antibody

The TRIM17 Antibody (Clone 2E11) is a monoclonal mouse IgG2a kappa antibody developed to detect human TRIM17 protein. It recognizes a partial recombinant protein fragment (amino acids 75–184) of TRIM17 fused to a GST tag . This antibody is validated for applications including:

  • Western Blot (1:500 dilution)

  • Immunocytochemistry/Immunofluorescence (10 µg/mL concentration)

  • Sandwich ELISA (detection limit: 0.03 ng/mL) .

TRIM17, also known as RNF16 or TERF, regulates ubiquitination processes and cellular stress responses, making this antibody essential for studying its expression and function .

Role in Neuronal Apoptosis

  • TRIM17 is indispensable for initiating neuronal apoptosis by degrading the anti-apoptotic protein MCL1 and promoting mitochondrial cytochrome c release .

  • Studies using TRIM17 antibodies confirmed its transient upregulation during stress-induced neuronal death, such as in cerebellar granule neurons (CGNs) deprived of survival factors .

Disease Associations

  • Parkinson’s Disease (PD): TRIM17 stabilizes ZSCAN21, a transcription factor linked to α-synuclein (SNCA) expression, by inhibiting TRIM41-mediated ubiquitination. Dysregulation of this pathway is implicated in PD pathogenesis .

  • Cancer: TRIM17 acts as a stress sensor, degrading oncoproteins like MCL1 or stabilizing tumor suppressors depending on cellular context .

Table 2: Validation Data

ApplicationResult
Western BlotDetects recombinant TRIM17 (~50 kDa band; GST tag: 26 kDa) .
ImmunofluorescenceLocalizes TRIM17 in HeLa cells with minimal background .
Functional StudiesKnockdown of TRIM17 reduces MCL1 ubiquitination and neuronal death .

The antibody’s utility in detecting endogenous TRIM17 was demonstrated in apoptotic neurons during cerebellar development and in models of trophic factor withdrawal .

Regulatory and Interaction Networks

TRIM17’s activity is modulated by:

  • SUMOylation: Interaction with NFAT transcription factors depends on SUMO-binding motifs (SIM1/SIM2) .

  • Phosphorylation: MCL1 degradation by TRIM17 requires prior phosphorylation of MCL1 .

Limitations and Considerations

  • Low basal TRIM17 expression in most tissues necessitates sensitive detection methods .

  • Commercial TRIM17 antibodies (e.g., Clone 2E11) are research-grade and not validated for clinical diagnostics .

Product Specs

Buffer
PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. Store at -20°C. Avoid freeze / thaw cycles.
Lead Time
We typically dispatch orders within 1-3 business days of receipt. Delivery times may vary depending on the purchasing method and location. Please contact your local distributor for specific delivery time information.
Synonyms
E3 ubiquitin-protein ligase TRIM17 antibody; RBCC antibody; RING finger protein 16 antibody; RING finger protein terf antibody; RNF16 antibody; TERF antibody; Testis RING finger protein antibody; TRI17_HUMAN antibody; TRIM 17 antibody; Trim17 antibody; Tripartite motif containing 17 antibody; Tripartite motif containing protein 17 antibody; Tripartite motif protein 17 antibody; Tripartite motif-containing protein 17 antibody
Target Names
TRIM17
Uniprot No.

Target Background

Function
TRIM17 is an E3 ubiquitin ligase that plays crucial roles in regulating neuronal apoptosis, selective autophagy, and cell proliferation. It promotes the degradation of the kinetochore ZW10 interacting protein ZWINT through a proteasome-dependent mechanism, thereby negatively regulating cell proliferation. TRIM17 inhibits autophagic degradation of various known targets while contributing to autophagy of midbodies. Its autophagy-inhibitory activity involves MCL1, with which TRIM17 forms complexes with the key autophagy regulator BECN1. TRIM17 controls neuronal apoptosis by mediating ubiquitination and degradation of MCL1, initiating neuronal death. Additionally, it regulates the activities of NFAT transcription factors NFATC3 and NFATC4 by preventing their nuclear localization, thereby inhibiting their transcriptional activities. TRIM17 decreases TRIM41-mediated degradation of ZSCAN2, stimulating alpha-synuclein/SNCA transcription in neuronal cells. It prevents the E3 ubiquitin-ligase activity of TRIM28 and its interaction with anti-apoptotic BCL2A1, inhibiting TRIM28 from ubiquitinating BCL2A1.
Gene References Into Functions
  1. TRIM17 facilitated the removal of midbodies, remnants of the cell division machinery that are known autophagy targets. PMID: 27562068
  2. NFATc3 interacted with Trim17, an E3 ubiquitin ligase essential for neuronal apoptosis, in a SUMO-dependent manner. PMID: 25215946
  3. terf interacts with TRIM44; TRIM44 inhibited ubiquitination of terf, stabilizing the protein. PMID: 19358823
Database Links

HGNC: 13430

OMIM: 606123

KEGG: hsa:51127

STRING: 9606.ENSP00000295033

UniGene: Hs.121748

Protein Families
TRIM/RBCC family
Subcellular Location
Cytoplasm. Lysosome.
Tissue Specificity
Almost exclusively in the testis.

Q&A

What is TRIM17 and what are its key biological functions?

TRIM17 is an E3 ubiquitin ligase belonging to the TRIM (tripartite motif) protein family. It contains multiple functional domains including a RING domain, B-box domain, Coiled-coil domain, and SPRY domain. TRIM17 plays crucial roles in:

  • Apoptosis regulation: TRIM17 can both inhibit and promote apoptosis depending on cellular context. In gastric cancer, TRIM17 promotes survival by interacting with BAX and promoting its ubiquitination and proteasomal degradation . Conversely, in neurons, TRIM17 can initiate apoptosis by mediating ubiquitination and degradation of MCL1 .

  • Selective autophagy regulation: TRIM17 uniquely functions as both an inhibitor and promoter of selective autophagy. It inhibits autophagic degradation of diverse targets while actively promoting the autophagy of midbodies (remnants of cell division machinery) .

  • Cancer progression: TRIM17 expression is upregulated in gastric cancer tissues compared to normal tissues, and high TRIM17 expression correlates with poor patient survival .

  • Cell proliferation: TRIM17 has been shown to stimulate the degradation of kinetochore ZW10 interacting protein ZWINT in a proteasome-dependent manner, leading to negative regulation of cell proliferation .

TRIM17 expression shows distinct regulation patterns:

  • Basal expression: TRIM17 is typically expressed at low levels in most tissues and cell types under normal conditions .

  • Tissue distribution: Higher expression has been observed in specific brain regions, particularly the cerebellum and neurons of the substantia nigra .

  • Stress-induced expression: TRIM17 expression can be dramatically induced following cellular stresses, suggesting it functions as a "sentinel" protein that triggers appropriate cellular responses .

  • Cancer-associated upregulation: In gastric cancer, both TRIM17 mRNA and protein levels are significantly upregulated compared to normal specimens .

  • Developmental expression: TRIM17 has been reported to be ubiquitously expressed during mouse embryonic development .

  • Expression dynamics: In many situations, TRIM17 induction appears to be very strong and transient, supporting its role as a sensor for cellular stress responses .

What are the known cellular substrates of TRIM17?

TRIM17 has several identified substrates that it regulates through its E3 ubiquitin ligase activity:

SubstrateRegulation TypeBiological EffectReference
BAXUbiquitination and degradationInhibits apoptosis in gastric cancer
MCL1Ubiquitination and degradationInitiates neuronal apoptosis
ZWINTDegradationNegative regulation of cell proliferation
BCL2A1Prevents TRIM28-mediated degradationPromotes survival in melanoma cells
MidbodiesPromotes autophagyFacilitates midbody removal

TRIM17 can act in seemingly contradictory ways - sometimes promoting degradation of its targets (BAX, MCL1) and other times preventing degradation (BCL2A1). This context-dependent function appears to be a unique feature of TRIM17 among TRIM family proteins .

What is the subcellular localization of TRIM17 and how does it affect function?

The subcellular localization of TRIM17 is important for its function:

  • Cytoplasmic distribution: TRIM17 is primarily localized in the cytoplasm where it accesses its substrates such as BAX .

  • Midbody association: During cell division, TRIM17 can associate with midbodies and regulate their autophagic removal .

  • Nuclear function: TRIM17 can regulate NFAT transcription factors (NFATC3 and NFATC4) by preventing their nuclear localization, thus inhibiting their transcriptional activities .

  • Localization changes: Under apoptotic conditions in neurons, increased TRIM17 expression can be detected by immunofluorescence, suggesting potential changes in localization or concentration during cell death processes .

When studying TRIM17 localization, confocal microscopy with specific antibodies is commonly used, though the endogenous protein can be difficult to detect due to low expression levels in many cell types .

How can researchers validate TRIM17 antibody specificity in their experimental systems?

Validating TRIM17 antibody specificity is critical due to its low endogenous expression in many cell types. Recommended validation approaches include:

  • Genetic knockdown controls: Use siRNA, shRNA, or CRISPR/Cas9 systems targeting TRIM17. In published studies, researchers observed decreased antibody signals in CGNs transduced with shRNA against TRIM17 and in SCG neurons microinjected with siRNAs targeting TRIM17, confirming antibody specificity .

  • Overexpression controls: Compare signals between cells overexpressing TRIM17 and control cells. The antibody should show increased signal in overexpression systems .

  • Multiple antibodies: Use at least two antibodies targeting different epitopes of TRIM17 to confirm consistent patterns.

  • Western blot validation: Verify that the antibody detects a band of the expected molecular weight (~54 kDa) that increases with overexpression and decreases with knockdown .

  • Inducible CRISPR/Cas9 system: For temporal control of TRIM17 depletion, researchers have used doxycycline-inducible CRISPR/Cas9 systems. This approach allowed validation of editing efficiency through T7E1 assay and next-generation sequencing to confirm InDels in the TRIM17 locus .

What are the optimal methods for studying TRIM17's E3 ligase activity in vitro and in vivo?

To study TRIM17's E3 ligase activity:

In vitro ubiquitination assays:

  • Recombinant TRIM17 protein can be used in ubiquitination assays with specific E2 conjugating enzymes (Ube2e1, Ube2d2, and Ube2d3 have shown activity with TRIM17) .

  • For auto-ubiquitination assays, incubate purified TRIM17 with E1, E2, ATP, and ubiquitin, then analyze by immunoblotting with both anti-TRIM17 and anti-ubiquitin antibodies.

  • Detection of mono-ubiquitinated TRIM17 appears as a single band with increased molecular weight, while poly-ubiquitination appears as a ladder of higher molecular weight species .

In vivo ubiquitination assays:

  • Co-express TRIM17, the potential substrate (e.g., BAX, MCL1), and His-tagged ubiquitin in cells.

  • Treat cells with proteasome inhibitors (e.g., MG132 at 20μM for 6h) to prevent degradation of ubiquitinated proteins .

  • Immunoprecipitate the substrate protein and detect ubiquitination by immunoblotting with anti-ubiquitin antibody.

  • Alternative approach: Use His-tagged ubiquitin pulldown under denaturing conditions followed by immunoblotting for the substrate protein.

For studying substrate degradation mechanisms:

  • Protein half-life assays using cycloheximide (CHX, 50μg/ml) chase experiments can determine if TRIM17 affects substrate stability .

  • Quantify band intensities using ImageJ software to calculate protein half-life .

How does TRIM17 differentially regulate autophagy, and what methods best capture this dual function?

TRIM17 uniquely functions as both an inhibitor and promoter of selective autophagy, depending on the target. To study this dual role:

Techniques to study TRIM17's inhibitory role in autophagy:

  • High-content imaging to quantify autophagy markers (p62, LC3) in TRIM17 knockdown or overexpressing cells .

  • Immunoblotting for p62 and LC3-II to assess autophagy flux .

  • Fluorescence microscopy to visualize p62 puncta as indicators of polyubiquitylated protein aggregates destined for autophagic degradation .

  • Autophagy induction with drugs like pp242 (mTOR inhibitor) and assessment of autophagic degradation of selective targets with or without TRIM17 expression .

Methods to study TRIM17's role in promoting midbody autophagy:

  • Fluorescence microscopy to visualize and quantify midbodies using markers like MKLP1 .

  • Co-localization studies between TRIM17, autophagy markers, and midbody markers .

  • Cell cycle analysis to rule out indirect effects on midbody numbers (as TRIM17 affects cell cycle progression) .

  • Lysosomal inhibition with bafilomycin A1 to assess if increased midbody numbers with TRIM17 knockdown are due to impaired autophagy .

Key molecular insights:

  • TRIM17's inhibitory function in autophagy has been traced to its actions on the anti-autophagy protein Mcl-1, which associates with and inactivates Beclin 1 .

  • The selective loss of anti-autophagy Mcl-1 from TRIM17–Beclin-1 complexes at midbodies correlates with TRIM17's ability to promote midbody removal .

What are the optimized protocols for co-immunoprecipitation experiments with TRIM17?

For successful co-immunoprecipitation (co-IP) experiments with TRIM17:

Sample preparation:

  • Treat cells with proteasome inhibitors (MG132, 20μM for 6h) prior to harvest to prevent degradation of ubiquitinated proteins and stabilize protein-protein interactions .

  • Lyse cells with Triton X-100 buffer (150 mM NaCl, 50 mM Tris, and 1% Triton X-100, pH 7.5) for 30 minutes at 4°C .

Immunoprecipitation procedure:

  • For tagged TRIM17: Use 20μl anti-Flag/anti-HA magnetic beads for immunoprecipitation of tagged TRIM17 proteins .

  • For endogenous TRIM17: Use 20μl Protein A/G magnetic beads containing 4μl TRIM17-specific antibody .

  • Incubate immunoprecipitation mixtures overnight at 4°C with gentle rotation.

  • Wash immunocomplexes five times with lysis buffer to reduce background .

  • Elute and analyze by immunoblotting.

Special considerations:

  • When studying TRIM17's interactions with potential substrates like BAX, co-IP experiments have shown that the RING domain and SPRY domain are critical for substrate binding. Deletion mutants (TRIM17ΔR or TRIM17ΔS) markedly failed to interact with BAX protein, whereas deletion of B-box domain (TRIM17ΔB) or Coiled coil domain (TRIM17ΔC) did not affect binding .

  • For investigating TRIM17's interaction with other E3 ligases like TRIM28, proximity ligation assay (PLA) can be used as a complementary approach to co-IP to detect protein-protein interactions in situ .

What experimental approaches are recommended for studying TRIM17's role in cancer progression?

Based on published research, the following approaches are recommended for investigating TRIM17's role in cancer:

Expression analysis in clinical samples:

  • Analyze TRIM17 mRNA levels in tumor vs. normal tissues using qRT-PCR with primers such as:

    • TRIM17: GACATGGAGTACCTTCGGGA (forward), GCAGTCTCCTCTTCTTCCGT (reverse)

  • Perform IHC staining of human cancer tissue microarrays with TRIM17 antibody (dilution 1:25-1:200 depending on antibody) .

  • Quantify IHC scores by multiplying staining intensity by percentage of positive staining .

  • Correlate TRIM17 expression with patient survival using Kaplan-Meier survival analysis .

Functional studies in cancer cell lines:

  • Knockdown TRIM17 using siRNAs or shRNA in cancer cell lines with high TRIM17 expression .

  • Assess effects on cell proliferation using colony formation assays and growth curve analysis .

  • Analyze apoptosis using FACS analysis and by detecting cleaved PARP and Caspase 3 levels .

  • Examine cell cycle distribution to determine if TRIM17 affects specific cell cycle phases .

Xenograft tumor models:

  • For knockdown experiments: Use NOD/SCID mice injected with cancer cells stably expressing sh-TRIM17 or sh-Control (8×10^6 cells/mouse) .

  • For overexpression studies: Use BALB/c nude mice implanted with xenografted tumor mass stably expressing TRIM17 or control vector .

  • Monitor tumor growth by measuring tumor dimensions twice weekly .

  • Perform IHC on tumor sections for proliferation markers (Ki-67) and apoptosis markers (cleaved Caspase 3) .

Mechanism investigation:

  • Study TRIM17's effect on potential oncogenic/tumor suppressor substrates using co-IP, ubiquitination assays, and protein stability assays .

  • Investigate chemosensitivity by treating TRIM17-depleted cancer cells with anticancer drugs and determining IC50 values .

  • Rescue experiments by co-depleting TRIM17 and its substrate (e.g., BAX) to verify substrate-dependent mechanisms .

How should researchers approach TRIM17 antibody selection for studying TRIM17's dual roles in different tissue contexts?

When selecting antibodies for studying TRIM17's context-dependent functions:

Epitope considerations:

  • Choose antibodies recognizing different epitopes depending on your research focus:

    • For studying E3 ligase activity: Antibodies targeting the RING domain region

    • For studying substrate interactions: Antibodies against the SPRY domain, which is critical for substrate binding

    • For general detection: Antibodies against conserved regions less likely to be masked by protein-protein interactions

Validation across tissue types:

  • Different tissue types may express various TRIM17 isoforms or post-translationally modified forms. Validate each antibody in your specific tissue context.

  • In neuronal systems, TRIM17 antibody sensitivity may be a concern as endogenous levels can be very low unless induced by apoptotic stimuli .

  • For cancer studies, validate antibodies in both tumor and normal tissue counterparts, as TRIM17 shows differential expression between these contexts .

Application-specific selection:

  • For detecting endogenous TRIM17 in cells with low expression: Select highly sensitive antibodies validated for immunofluorescence in similar contexts .

  • For studies involving protein-protein interactions: Ensure the antibody's epitope doesn't overlap with binding regions of interaction partners.

  • For IHC applications: Use antibodies specifically validated for IHC with optimized antigen retrieval protocols (TE buffer pH 9.0 or citrate buffer pH 6.0) .

The contextual function of TRIM17 (pro-apoptotic in neurons vs. anti-apoptotic in cancer cells) necessitates careful antibody selection and experimental design to accurately interpret results across different biological systems.

Quick Inquiry

Personal Email Detected
Please use an institutional or corporate email address for inquiries. Personal email accounts ( such as Gmail, Yahoo, and Outlook) are not accepted. *
© Copyright 2025 TheBiotek. All Rights Reserved.