TRIM21 Antibody

What is TRIM21 and how does it function in antibody-mediated immunity?

TRIM21 is a cytosolic Fc receptor that plays a pivotal role in intracellular immunity by recognizing and binding to antibodies that have entered the cell attached to pathogens. Unlike classical Fc receptors that function at the cell surface, TRIM21 operates within the cytosol to provide post-entry protection against viruses.

TRIM21 initiates two distinct processes upon binding to antibody-coated pathogens:

• Effector response: TRIM21 recruits cellular degradation machinery, including the AAA ATPase VCP and the proteasome, resulting in the destruction of viral particles and neutralization of infection in a process known as antibody-dependent intracellular neutralization (ADIN) .

• Sensor response: TRIM21 activates immune transcription pathways, including NF-κB, leading to potent upregulation of pro-inflammatory cytokines including TNF, CXCL10, IL-6, and interferons .

TRIM21-mediated antiviral activity has been demonstrated against a wide range of non-enveloped viruses, including adenovirus, Porcine reproductive and respiratory syndrome virus (PRRS), Japanese encephalitis virus (JEV), Hepatitis B virus (HBV), and rotavirus . Deletion of TRIM21 compromises the efficiency of protective antibody immunity and can cause virus-induced mortality .

How does TRIM21 differ from conventional Fc receptors in antibody binding properties?

TRIM21 exhibits several unique characteristics that distinguish it from classical Fc receptors:

• Broad isotype specificity: While most Fc receptors are highly selective regarding antibody isotype binding, TRIM21 can bind IgG, IgM, and IgA with high affinity . This allows TRIM21 to engage with a diverse range of antibody-bound pathogens.

• Binding affinity: TRIM21 binds to the Fc region of antibodies with exceptionally high affinity (sub-nanomolar KD for IgG), making it the highest-affinity antibody receptor in the human body .

• Expression pattern: TRIM21 is broadly expressed by cells of most histogenic lineages, while expression of classical FcγRs is mainly restricted to hematopoietic cells .

• Cellular localization: Unlike conventional Fc receptors that function at the cell surface, TRIM21 operates in the cytosolic compartment, providing an additional layer of immune protection against pathogens that breach the cell membrane .

• Structure: TRIM21 is structurally, functionally, and evolutionarily distinct from surface FcRs .

What are the key domains of TRIM21 and their roles in antibody binding?

TRIM21 is a multidomain protein with distinct functional components that work together to enable antibody recognition and downstream effects:

• RING domain: Possesses E3 ubiquitin ligase activity essential for the activation of the proteasomal degradation pathway. Upon target-induced clustering (between two or more TRIM21 dimers), intermolecular dimerization of the RING domains triggers ubiquitination activity .

• B-Box domain: Contributes to protein stability and function.

• Coiled-coil (CC) domain: Critical for TRIM21 dimerization, which enables simultaneous engagement of both heavy chains of an antibody, dramatically increasing binding affinity .

• PRYSPRY domain: Directly interacts with the Fc portion of antibodies. While the monomeric PRYSPRY domain binds with approximately 150 nM affinity to IgG, the dimeric structure of full-length TRIM21 binds with sub-nanomolar affinity due to avidity effects .

Recent research suggests a novel binding mechanism where TRIM21 binding to one Fc site results in the detachment of PRYSPRY from the coiled-coil domain, enhancing mobility due to its flexible linker, thereby facilitating the engagement of the second site, resulting in avidity through bivalent engagement .

What experimental approaches are most effective for studying TRIM21-antibody interactions?

A comprehensive investigation of TRIM21-antibody interactions requires multiple complementary techniques:

• Biosensor assays: Surface plasmon resonance (SPR) or biolayer interferometry (BLI) can be used to measure the kinetics and affinity of TRIM21 binding to different antibody isotypes and Fc-engineered variants .

• Fluorescence titration spectroscopy: This technique has proven valuable for determining the dissociation constant (KD) of TRIM21-antibody interactions with high precision, revealing the sub-nanomolar affinity of full-length TRIM21 for IgG .

• Multi-angle light scattering (MALS): MALS analysis has been instrumental in determining that recombinant full-length TRIM21 forms a stable dimer and not a trimer as previously reported. When mixed with IgG, TRIM21 forms a stoichiometric complex consisting of one antibody and one TRIM21 dimer .

• Mass photometry: This emerging technique allows direct observation of protein complexes at the single-molecule level and can reveal heterogeneity in binding stoichiometries .

• Electron microscopy: Negative-stain or cryo-electron microscopy can visualize TRIM21-antibody complexes and provide structural insights into the binding interface .

• Structure predictions: Computational approaches, combined with experimental data, can help model the TRIM21-antibody interaction interface and predict the effects of mutations .

How can I establish reliable TRIM21 knockout and reconstitution models?

Generating TRIM21 knockout models is essential for investigating TRIM21-dependent effects. The following approaches have proven effective:

• CRISPR-Cas9 ribonucleoprotein (RNP) complex:

  • Design guide RNAs targeting the TRIM21 gene (example target sequence: ATGCTCACAGGCTCCACGAA)

  • Form Cas9 RNP complex by incubating synthetic tracrRNA-crRNA with recombinant Cas9 protein

  • Introduce the complex into cells using electroporation (e.g., using Neon Transfection System with settings such as 2 pulses of 1400V for 20ms for 293T cells)

  • Clone cells by fluorescence-activated cell sorting into 96-well plates (1 cell/well)

  • Confirm knockout by immunoblotting for TRIM21 protein

• siRNA approach for transient depletion:

  • While not a permanent knockout, siRNA can be used for initial validation experiments

  • Compare results from control siRNA and TRIM21 siRNA treatments

  • Consider the effects of IFN-α treatment, which upregulates TRIM21 expression

• Reconstitution systems:

  • Reintroduce wild-type or mutant TRIM21 into knockout cells

  • Use lentiviral vectors for stable expression

  • Include epitope tags (e.g., His tag) for detection and purification

  • Validate expression levels compared to endogenous TRIM21

When establishing these models, it's crucial to:

• Verify knockout by both genomic analysis and protein expression testing

• Confirm functional effects using viral neutralization assays

• Compare multiple cell lines, as TRIM21 expression and function may vary

• Include appropriate controls in all experiments

What assays can precisely measure TRIM21-mediated viral neutralization?

Several complementary assays can be used to measure TRIM21-mediated viral neutralization:

• Reporter virus neutralization assay:

  • Use viruses expressing reporter genes (e.g., GFP)

  • Pre-incubate virus with varying concentrations of antibodies

  • Infect cells (with or without TRIM21 depletion/knockout)

  • Measure reporter expression to quantify infection efficiency

  • In standard assays, adenovirus infects approximately 50% of cells without antibody, but the percentage decreases rapidly with increasing antibody concentration (e.g., 60-fold reduction at 400 ng/mL antibody in TRIM21-sufficient cells, compared to only 3-fold in TRIM21-depleted cells)

• Genome-to-expression discrepancy analysis:

  • Measure viral genome delivery by qPCR

  • Compare with transgene expression levels

  • This reveals TRIM21's role in blocking expression without preventing genome delivery

• Inflammatory signaling measurement:

  • Quantify activation of NF-κB, AP-1, and IRF3/5/7 transcription factors

  • Measure cytokine production (TNF, CXCL10, IL-6, IFNs)

  • Transcriptomic analysis can reveal hundreds of immune genes specifically upregulated through TRIM21 activity

• Microscopy-based approaches:

  • Visualize co-localization of TRIM21 with antibody-coated viruses

  • Track recruitment of ubiquitination and proteasomal machinery

  • Monitor viral degradation kinetics

When designing neutralization assays, consider:

• Including both TRIM21-sufficient and TRIM21-deficient cells

• Testing a range of antibody concentrations to establish dose-response relationships

• Pre-treating cells with IFN-α to upregulate TRIM21 expression

• Using various antibody isotypes (IgG, IgM, IgA) to compare their relative efficiency

How does TRIM21 interact with different antibody isotypes and what are the functional implications?

TRIM21 exhibits differential binding to various antibody isotypes, with important functional consequences:

• Isotype-specific binding characteristics:

  • IgG: TRIM21 binds IgG with sub-nanomolar affinity, making this the strongest interaction .

  • IgM: The monomeric PRYSPRY domain binds IgM with a KD of approximately 17 μM .

  • IgA: The monomeric PRYSPRY domain binds IgA with a KD of approximately 50 μM .

• Structural basis for broad isotype recognition:

  • The binding site for TRIM21 on IgA and IgM overlaps with that of Fcα receptor I (FcαRI), Fcα/μ receptor, and polymeric immunoglobulin receptor (pIgR) .

  • Despite relatively weak monomeric binding, the dimeric nature of full-length TRIM21 suggests that functional affinities for IgM and IgA are much stronger, potentially in the sub-micromolar range during physiological conditions .

• Functional consequences:

  • All three major isotypes (IgG, IgM, IgA) can activate TRIM21-dependent viral neutralization, though with varying efficiency .

  • The number of antibodies required for effective neutralization varies:

    • IFN-stimulated mouse cells: Only 1.6 antibodies per virus needed

    • IFN-stimulated human cells: Approximately 5 antibodies per virus required

    • Non-stimulated human cells: More antibodies needed

• Special considerations for secretory IgA (S-IgA):

  • Despite reduced affinity for S-IgA due to the secretory component (SC), virus-specific S-IgA from human serum can activate ADIN .

  • The disulfide bonds between IgA and SC may be broken upon exposure to the reducing environment of the cytosol, allowing TRIM21 attachment .

  • S-IgA forms trimers and tetramers in nasal secretions that contribute to enhanced neutralization potency .

These findings have important implications for understanding how antibodies of different isotypes contribute to intracellular immunity across various tissues and infection routes.

What is the mechanism of TRIM21-mediated ubiquitination and proteasomal targeting?

TRIM21 employs a sophisticated ubiquitination cascade to target antibody-bound viruses for degradation:

• Initial recognition and activation:

  • TRIM21 dimers bind to the Fc portion of antibodies coating viral particles

  • Target-induced clustering is proposed to trigger activation of TRIM21's E3 ubiquitin ligase activity

  • Intermolecular dimerization of RING domains (between two or more TRIM21 dimers) is thought to be the critical step in activation

• Ubiquitination cascade:

  • Upon activation, TRIM21 sequentially recruits E2 ubiquitin-conjugating enzymes

  • First, Ube2W attaches ubiquitin to the N-terminus of TRIM21

  • Then, Ube2N/Ube2V2 extends this with K63-linked polyubiquitin chains

• Proteasome recruitment:

  • The K63-linked polyubiquitin chains recruit the AAA ATPase VCP and the proteasome

  • This machinery efficiently unfolds and degrades the viral capsid and associated antibodies

  • The process is rapid, occurring before the virus has time to replicate

• Dual outcomes:

  • Viral neutralization: The direct degradation of the virus prevents infection

  • Immune signaling: The proteasome-associated deubiquitinase PohI liberates K63-linked ubiquitin chains, which activate immune signaling pathways

• Efficiency considerations:

  • The efficiency of TRIM21-mediated degradation is influenced by:

    • TRIM21 expression levels (enhanced by IFN)

    • Number of antibodies bound to the virus

    • Antibody isotype and subclass

    • Target structure (may influence clustering)

Understanding this mechanistic pathway has important implications for both antiviral immunity and potential therapeutic interventions targeting the TRIM21 pathway.

How can Fc engineering of antibodies be utilized to modulate TRIM21 activity?

Fc engineering offers powerful approaches to modulate TRIM21-antibody interactions for research and therapeutic applications:

• Engineering for enhanced TRIM21 binding:

  • Specific mutations in the antibody Fc region can increase affinity for TRIM21

  • This could enhance intracellular neutralization of viruses

  • Research has focused on understanding the balance between affinity (strength of individual binding) and avidity (combined strength of multiple interactions)

• Engineering to prevent TRIM21 binding:

  • For gene therapy applications, antibodies engineered to avoid TRIM21 recognition could improve transgene delivery by preventing neutralization of antibody-opsonized viral vectors

  • Single-point mutations can significantly modify PRYSPRY binding

• Asymmetrical Fc engineering:

  • Creating antibodies with asymmetrical, varying heavy chains rather than symmetrical, similar heavy chains

  • This approach allows fine-tuning of TRIM21 engagement

• Structure-guided engineering:

  • The novel binding mechanism where TRIM21 binding to one Fc site results in PRYSPRY detachment from the coiled-coil domain provides new targets for strategic engineering

  • Mutations affecting the flexibility of the linker between PRYSPRY and coiled-coil domains could modulate TRIM21 function

• Isotype-specific engineering:

  • Different engineering approaches may be required for IgG, IgM, and IgA due to their distinct baseline affinities for TRIM21

  • Hybrid antibodies combining domains from different isotypes offer additional engineering possibilities

Research in this area has employed multiple approaches:

• Creation of antibody Fc mutant libraries

• Biosensor assays to measure binding dynamics

• Mass photometry to assess stoichiometry

• Electron microscopy to visualize complexes

• In vivo testing to validate functional consequences

Fc engineering holds significant promise for both enhancing antiviral activity and improving gene therapy outcomes by selectively controlling TRIM21 engagement.

What are the implications of TRIM21 in autoimmune diseases?

TRIM21 has significant associations with autoimmune conditions:

• TRIM21 as an autoantigen:

  • TRIM21 (also known as Ro52 or SSA) is a major autoantigen in several autoimmune diseases

  • Anti-TRIM21 autoantibodies are found in:

    • Systemic lupus erythematosus (SLE)

    • Sjögren's syndrome

    • Systemic sclerosis

• Pathogenic mechanisms:

  • TRIM21 is associated with hyperactivation of the type 1 interferon response in autoimmune diseases

  • As an E3 ubiquitin ligase, TRIM21 regulates the stability and activity of IRF transcription factors

  • Dysregulation of this pathway contributes to excessive interferon production characteristic of many autoimmune conditions

• Diagnostic significance:

  • Anti-TRIM21/Ro52 antibodies serve as important diagnostic markers

  • These antibodies are detected in standard autoimmune panels

  • They can provide prognostic information for certain autoimmune diseases

• Pregnancy implications:

  • Maternal anti-TRIM21 antibodies can cross the placenta

  • This is associated with neonatal lupus and congenital heart block

Research approaches in this area include:

• Investigating how anti-TRIM21 autoantibodies affect normal TRIM21 function

• Exploring whether TRIM21 polymorphisms alter autoimmune susceptibility

• Developing therapeutic approaches targeting TRIM21 in autoimmune diseases

• Understanding the mechanisms driving anti-TRIM21 autoantibody production

How does TRIM21 impact adenovirus-based gene therapy and vaccination strategies?

TRIM21 has major implications for adenovirus-based therapeutic platforms:

These findings have important implications for the development and optimization of adenoviral vectors for both gene therapy and vaccination applications.

What potential exists for therapeutic targeting of the TRIM21 pathway?

The unique properties of TRIM21 present several promising therapeutic opportunities:

These therapeutic directions require careful consideration of:

• Tissue-specific targeting to limit off-target effects

• Temporal control for transient modulation when needed

• Combinatorial approaches with existing therapies

• Personalized approaches based on individual TRIM21 expression levels

How can researchers distinguish between different antibody effector mechanisms when studying TRIM21?

Distinguishing between TRIM21-dependent and other antibody effector mechanisms requires careful experimental design:

• Genetic approaches:

  • Use TRIM21 knockout cells as the gold standard to determine TRIM21 dependency

  • Compare with wild-type cells to quantify the TRIM21-specific contribution

  • Include TRIM21-reconstituted cells to confirm specificity

  • Employ domain-specific TRIM21 mutants to dissect mechanisms

• Antibody engineering strategies:

  • Use antibodies with mutations that specifically disrupt TRIM21 binding

  • Compare wild-type antibodies with TRIM21-binding deficient variants

  • This enables isolation of TRIM21-specific effects while maintaining the same antibody concentration and epitope targeting

  • Studies have demonstrated that single-point mutations in antibodies can restore transgene expression in the presence of preexisting immunity

• Compartment-specific analysis:

  • Classical neutralization: Acts at the cell surface to block virus attachment or entry

  • ADCC/CDC: Requires immune effector cells or complement and acts extracellularly

  • TRIM21-mediated ADIN: Functions post-entry in the cytosol

  • Analyzing viral fate in different cellular compartments can help determine the active mechanism

• Timing-based approaches:

  • TRIM21 acts post-entry but pre-replication

  • Time-of-addition experiments with neutralizing antibodies can help distinguish mechanisms

  • TRIM21-mediated neutralization occurs rapidly after cytosolic entry

• Combinatorial experiments:

  • Blocking specific pathways while leaving others intact

  • Using Fab fragments (which lack Fc regions) to assess neutralization in the absence of Fc-mediated effects

  • Combining TRIM21 knockout with other interventions (e.g., complement depletion)

Careful experimental design with appropriate controls is essential for accurate interpretation of results in this complex area.

What factors affect TRIM21 expression levels and how should researchers account for them?

TRIM21 expression is dynamically regulated, requiring researchers to consider several factors:

• Interferon regulation:

  • TRIM21 is strongly upregulated by type I interferons (particularly IFN-α)

  • IFN-α treatment can substantially increase endogenous TRIM21 protein levels

  • The modest levels of TRIM21 under basal conditions are significantly enhanced following interferon stimulation

• Cell type variation:

  • While TRIM21 is broadly expressed across cell types, basal expression levels vary significantly

  • Immune cells typically show higher constitutive expression

  • Expression in non-immune tissues may be more dependent on interferon stimulation

• Species differences:

  • Important differences exist between human and mouse TRIM21:

    • IFN-stimulated mouse cells require only 1.6 antibodies per virus for effective neutralization

    • IFN-stimulated human cells require approximately 5 antibodies for similar efficacy

  • These differences should be considered when translating findings between species

• Experimental design considerations:

  • Always include IFN-stimulated and unstimulated conditions

  • Verify TRIM21 expression levels by Western blot in each experiment

  • Use standardized IFN treatments (e.g., 1000 U/ml for 24 hours)

  • Include time-course experiments to capture expression dynamics

• Pathophysiological context:

  • During infection, local IFN production will upregulate TRIM21

  • This creates a positive feedback loop where initial TRIM21 activation leads to increased expression

  • The kinetics of this upregulation should be considered when interpreting experimental results

A systematic approach to controlling for TRIM21 expression includes:

• Quantifying TRIM21 at the protein and mRNA level in experimental systems

• Using IFN receptor knockout controls to confirm specificity of regulation

• Considering TRIM21 expression levels when comparing results across different cell types or studies

• Titrating IFN concentrations to establish dose-dependent relationships

What are the key challenges in translating TRIM21 research findings to clinical applications?

Translating TRIM21 research to clinical applications faces several challenges:

• Complexity of in vivo TRIM21 function:

  • TRIM21 operates differently across tissues and cell types

  • It has dual roles (effector and sensor)

  • The balance between viral clearance and inflammatory signaling must be carefully considered

  • TRIM21 interacts with multiple antibody isotypes with varying efficiency

• Targeting challenges:

  • Cell-specific delivery of TRIM21-modulating agents is difficult

  • Temporary versus permanent modulation may be required depending on the application

  • The cytosolic location of TRIM21 makes it challenging to access with large biological molecules

• Regulatory considerations:

  • Safety concerns with modifying intracellular immune pathways

  • Potential for off-target effects when manipulating ubiquitination pathways

  • Long-term consequences of TRIM21 modulation are not well understood

• Technical hurdles:

  • Development of specific TRIM21 inhibitors or enhancers

  • Delivery of Fc-engineered antibodies to relevant tissues

  • Quantifying TRIM21 activity in vivo

  • Biomarkers for patient stratification

• Preexisting immunity considerations:

  • Adenovirus-based therapeutics face challenges from widespread preexisting immunity

  • Patient screening for anti-adenovirus antibodies adds complexity

  • Individual variation in TRIM21 expression and function

Potential strategies to address these challenges include:

• Development of small molecule modulators of TRIM21 function

• Targeted genetic approaches to modify TRIM21 in specific tissues

• Combination therapies that address multiple aspects of immune response

• Personalized approaches based on individual TRIM21 expression and antibody profiles

• Alternative vector designs that evade antibody recognition