TRPV6 Antibody

Shipped with Ice Packs
In Stock

Description

Introduction to TRPV6 and Its Significance

TRPV6 is a highly selective calcium channel that normally functions in calcium absorption in the intestine and kidney. It belongs to the vanilloid family of transient receptor potential calcium channel proteins, which are characterized by an N-terminal ankyrin repeat domain essential for channel assembly and regulation . The significance of TRPV6 extends beyond normal physiology into pathological contexts, particularly cancer, where it has been identified as an "oncochannel" overexpressed in various epithelial malignancies .

Research has revealed that TRPV6 is expressed de novo in prostate cancer cells, where it alters calcium homeostasis to increase cancer cell survival by enhancing proliferation and conferring resistance to apoptosis . This association with cancer progression has intensified interest in developing reliable antibodies that can accurately detect and study TRPV6 in both research and clinical settings.

Generation of Rabbit Polyclonal Anti-TRPV6 Antibodies

A significant advancement in TRPV6 research came with the development of rabbit polyclonal antibodies targeting specific epitopes of the TRPV6 channel. Researchers analyzed the complete TRPV6 protein sequence from UniProt (Q9H1D0) and designed four unique epitopes covering distinct domains: the N-terminus, X-loop, pore region, and C-terminus .

The generation process involved the AS-SMAF-SINGLE Rabbit—Speedy 28 days program, with antigens synthesized specifically for each target domain. The resulting antibodies were designated as follows:

  • rb80: targeting the N-terminus

  • rb79: targeting the extracellular loop (X-loop)

  • rb82: targeting the pore region

  • rb81: targeting the C-terminus

The immune response was carefully monitored by comparing dilutions of pre-immune serum (collected before immunization) with large bleed samples (obtained 21 days post-immunization). Due to the complexity and low antigenicity of the pore antigen, researchers implemented an extended 87-day program with additional weekly boosts for the rb82 antibody .

Validation Through Immunoblotting

Validation of TRPV6 antibodies typically begins with immunoblotting to confirm specificity and determine the molecular weight of the detected protein. For instance, when testing the rb79 antibody on total lysates from LNCaP, DU-145, PC-3, and PC-3M prostate cancer cell lines, researchers observed the expected glycosylated form of the protein at approximately 95-100 kDa, compared to the theoretical size of 87.3 kDa for the unglycosylated protein .

During validation, it's common to encounter non-specific bands, as was the case with a 50 kDa band detected in some experiments. Identifying and characterizing such non-specific interactions is crucial for ensuring accurate interpretation of results in subsequent applications .

Validation Through RNA Interference

A more rigorous validation approach involves small interfering RNA (siRNA) knockdown experiments to confirm antibody specificity. Researchers employed four different siRNAs targeting various exons of TRPV6 mRNA to validate the rb79 antibody. The siRNA sequences used included:

Target and Accession NumberSequence
TRPV6 siRNA-1 (NM_018646)5′-CCUGCUGCAGCAGAAGAGG (dTdT)-3′

These siRNAs achieved more than 60% knockdown efficiency at the mRNA level, as confirmed by quantitative real-time PCR. This reduction in mRNA expression corresponded with decreased protein levels detected by immunoblotting with the rb79 antibody, confirming its specificity for TRPV6 .

Validation Through Immunoprecipitation

Immunoprecipitation provides another method to validate antibody specificity while demonstrating its utility for this application. When researchers performed immunoprecipitation with the rb79 antibody on LNCaP cell lysates, they observed two distinct bands corresponding to glycosylated and non-glycosylated forms of TRPV6. Interestingly, the non-specific 50 kDa band observed in direct immunoblotting disappeared in immunoprecipitation samples, further supporting the specificity of rb79 for TRPV6 .

Immunoblotting (Western Blotting)

TRPV6 antibodies are routinely used in immunoblotting to detect and quantify TRPV6 protein expression across various cell types and tissues. For optimal results with commercial antibodies like bs-15506R, recommended dilutions range from 1:300 to 1:5000, depending on the specific sample and detection method .

Primers used for validating TRPV6 expression at the mRNA level before immunoblotting include:

Accession NumberForward PrimerBackward PrimerExpected Size (b.p)
TRPV6, NM_018646CCCTCAGTGTCTCGAAGTACTCAGATCTGATATTCCCAGCTC134
TRPV6, NM_018646CCCAAGGAGAAAGGGCTAATTTGGCAGCTAGAAGGAGAGG145

Immunohistochemistry

One of the most valuable applications of TRPV6 antibodies is immunohistochemistry on tissue samples, particularly paraffin-embedded sections from cancer resection specimens. Using prostate cancer tissues, researchers have demonstrated that TRPV6 protein is absent in healthy prostate tissue and benign hyperplasia but present in cancerous tissue, with expression levels correlating with cancer grade .

For immunohistochemistry applications, commercial antibodies typically recommend dilutions of 1:200-400 for paraffin-embedded sections (IHC-P) and 1:100-500 for frozen sections (IHC-F) .

Immunofluorescence and Flow Cytometry

TRPV6 antibodies targeting extracellular epitopes, such as rb79, are particularly useful for detecting TRPV6 channels on the cell surface using immunofluorescence. In non-permeabilized cells, these antibodies can exclusively stain plasma membrane-localized TRPV6, providing valuable information about channel trafficking and localization .

Additionally, TRPV6 antibodies can be employed in flow cytometry (FACS) for quantitative analysis of TRPV6 expression in cell populations. For immunofluorescence applications, typical dilutions range from 1:50 to 1:200, while flow cytometry generally requires dilutions of 1:20 to 1:100 .

ApplicationRecommended Dilution
Immunoblotting (WB)1:300-5000
ELISA1:500-1000
Flow Cytometry (FCM)1:20-100
Immunohistochemistry (IHC-P)1:200-400
Immunohistochemistry (IHC-F)1:100-500
Immunofluorescence (IHC-P)1:50-200
Immunofluorescence (IHC-F)1:50-200
Immunofluorescence (ICC)1:50-200
Immunocytochemistry (ICC)1:100-500

TRPV6 as a Cancer Biomarker

TRPV6 antibodies have proven instrumental in establishing TRPV6 as a potential biomarker in cancer research. Studies utilizing these antibodies have demonstrated that TRPV6 is overexpressed in various epithelial cancers, particularly prostate cancer, where it functions as an "oncochannel" .

Immunohistochemical analysis of xenograft tumors in nude mice using TRPV6 antibodies has revealed correlations between TRPV6 expression and other clinical markers associated with poor prognosis, including Ki-67, prostate-specific antigen, synaptophysin, CD31, and CD56 . These findings suggest that TRPV6 antibodies may have diagnostic and prognostic value in clinical oncology.

Mechanism Studies of TRPV6 in Cancer

TRPV6 antibodies have helped elucidate the mechanisms by which TRPV6 contributes to cancer progression. Research has shown that TRPV6 mediates calcium entry in prostate cancer cells through a remodeling mechanism involving the translocation of TRPV6 channels to the plasma membrane via the Orai1/TRPC1-mediated calcium/Annexin I/S100A11 pathway .

This mechanistic insight has led to the development of first-in-class TRPV6 inhibitors for potential cancer treatment, such as QED-203, which has demonstrated inhibition of calcium influx at low nanomolar potency in TRPV6 cellular assays . As these therapeutic approaches advance, TRPV6 antibodies will continue to play a crucial role in validating target engagement and monitoring treatment response.

Future Directions in TRPV6 Antibody Research

The development of novel TRPV6 antibodies continues to be an active area of research, driven by the growing recognition of TRPV6's importance in cancer biology and its potential as a therapeutic target. Current research focuses on several key areas:

  1. Development of monoclonal antibodies with enhanced specificity for various TRPV6 epitopes

  2. Creation of antibodies suitable for in vivo imaging of TRPV6-expressing tumors

  3. Exploration of therapeutic antibodies targeting TRPV6 for cancer treatment

  4. Investigation of TRPV6 antibodies as companion diagnostics for TRPV6-targeted therapies

These ongoing efforts aim to expand the toolkit available for studying TRPV6 in various contexts and to translate basic research findings into clinical applications.

Product Specs

Buffer
PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. Store at -20°C. Avoid freeze/thaw cycles.
Lead Time
We typically dispatch products within 1-3 business days after receiving your orders. Delivery times may vary depending on the purchasing method or location. Please consult your local distributor for specific delivery time estimates.
Synonyms
TRPV6; ECAC2; Transient receptor potential cation channel subfamily V member 6; TrpV6; CaT-like; CaT-L; Calcium transport protein 1; CaT1; Epithelial calcium channel 2
Target Names
Uniprot No.

Target Background

Function
TRPV6 is a calcium-selective cation channel that facilitates Ca(2+) uptake in various tissues, including the intestine. It plays a crucial role in maintaining normal Ca(2+) ion homeostasis throughout the body, particularly in bone and skin. Activation of the channel is triggered by low internal calcium levels, potentially including depletion of intracellular calcium stores. The resulting current exhibits inward rectification. Inactivation occurs through two mechanisms: a rapid Ca(2+)-dependent mechanism and a slower Ca(2+)-calmodulin-dependent mechanism, the latter potentially regulated by phosphorylation. In vitro, TRPV6 is slowly inhibited by Mg(2+) in a voltage-independent manner. Heteromeric assembly with TRPV5 can modify channel properties. TRPV5-TRPV6 heteromultimeric concatemers demonstrate voltage-dependent gating.
Gene References Into Functions
  1. Transient neonatal hyperparathyroidism, an autosomal-recessive disorder, is caused by TRPV6 mutations affecting maternal-fetal calcium transport. PMID: 29861107
  2. This review explores the role of TRPV6 in male fertility and cancer. PMID: 28501141
  3. Elevated TRPV6 expression is associated with the development and progression of pancreatic cancer. PMID: 29344675
  4. Cryo-electron microscopy structures of human TRPV6 in both the open and closed states have been determined. PMID: 29258289
  5. TRPV5 and TRPV6 lack a positively charged residue in the TM4-TM5 loop, which is known to interact with PI(4,5)P2 in TRPV1, a channel displaying high affinity for this lipid. PMID: 27291418
  6. Downregulation of TRPV6 is linked to a decreased Ca(2+) response pattern and reduced NFAT activity. PMID: 27450545
  7. TRPV6 expression is significantly diminished in chondrocytes from patients with osteoarthritis of the knees. TRPV6 may regulate specific chondrocyte functions, including extracellular matrix secretion, cell proliferation, and apoptosis. PMID: 28063212
  8. These findings indicate that p38alpha and GADD45alpha are involved in enhanced vitamin D signaling on TRPV6 expression. PMID: 28578001
  9. TRPV6 downregulation is associated with esophageal squamous cell carcinoma and is a predictive factor for survival in both male and female patients. PMID: 26818094
  10. These results suggest that CAT-1 is a novel CAM that directly regulates endothelial integrity and mediates the protective effects of L-Arg on endothelium via a NO-independent mechanism. PMID: 26283571
  11. The TRPV6 calcium ion channel plays a critical role in flow-induced Ca(2+) influx and microvilli formation. PMID: 26563429
  12. Our findings demonstrate that hCAT-1 is a key component of efficient T-cell activation. PMID: 26449889
  13. TRPV6 and PLC-delta1 are critical components of Ca(2+) homeostasis in CF human bronchial epithelial cells. PMID: 25477137
  14. This research focuses on TRPV6 gene polymorphisms, the initiation of TRPV6 translation at a non-AUG codon, and the functions of TRPV6 in intestinal Ca(2+) uptake, sperm maturation, and male fertility. PMID: 25372600
  15. The TRPV6 calcium ion channel acquires its oncogenic potential in prostate cancer through a remodeling mechanism involving the Orai1-mediated calcium/Annexin I/S100A11 pathway. PMID: 25172921
  16. High TRPV6 expression is associated with adenoma of the parathyroid glands. PMID: 25164318
  17. A non-AUG start codon is utilized in both humans and mice, extending the N-terminus of the protein by 40 amino acids. The increased translation of the smaller TRPV6 cDNA version might overestimate the in vivo situation, where translational efficiency may represent an additional mechanism for tightly controlling TRPV6-mediated Ca(2+) entry, preventing detrimental Ca(2+) overload. PMID: 23612980
  18. Decreased expression of TRPV6 is associated with non-small cell lung cancer. PMID: 24761864
  19. These findings suggest that TRPV5 and TRPV6 are essential regulators of cadmium and zinc levels in the human body. PMID: 23968883
  20. This study demonstrated that TRPV5/TRPV6 in human lymphocytes are functionally active and their activity is linked to the proliferative status of blood cells. PMID: 24592736
  21. Overexpression of miR-122 and concomitant suppression of CAT1 in the primary tumor appear to play significant roles in the development of colorectal liver metastasis. PMID: 23373973
  22. The interaction of TRPV6 and Numb1 influences TRPV6-mediated Ca2+ influx. PMID: 23140583
  23. Increased TRPV6 expression is a characteristic of estrogen receptor (ER)-negative breast tumors. PMID: 22807578
  24. Ca(2+), CaM, and the depletion of PI(4,5)P(2) all contribute to the inactivation of TRPV6. PMID: 23300090
  25. The function of intestinal TRPV6 in calcium and bone metabolism was investigated in both wild-type (WT) and vitamin D receptor knockout (VDRKO) mice. PMID: 22589201
  26. A functional interaction of TRPC1 with TRPV6 that negatively regulates Ca(2+) influx in HEK293 cells has been observed. PMID: 22932896
  27. TRPV6 is a close homolog of TRPV5, yet their calmodulin binding sites exhibit variations in binding modes, binding stoichiometries, and binding affinities, which may fine-tune the channels' response to varying Ca(2+)-concentrations. PMID: 22354706
  28. Knocking down endogenous OCRL through an antisense approach increased TRPV6-mediated Ca(2+) transport and TRPV6 forward trafficking. PMID: 22378746
  29. Data suggest that the transient receptor potential ion channel TRPV6 is expressed at only low levels in osteoblasts and plays a limited functional role in osteoblastic calcium uptake. PMID: 22163264
  30. Data indicate that TRPV6 and other proteins involved in transcellular Ca(2+) transport are dynamically expressed in bone cells, while TRPV6 does not appear to be crucial for bone metabolism and matrix mineralization. PMID: 21732366
  31. Our findings establish PtdIns(4,5)P(2) as a direct activator of TRPV6 and demonstrate that intracellular ATP regulates the channel indirectly as a substrate for type III PI4Ks. PMID: 21810903
  32. Immunohistochemical analysis of the distribution of TRPV6 and PMCA1 in the uterus revealed that both proteins are abundantly expressed in the cytoplasm of endometrial and glandular epithelial cells during menstrual phases. PMID: 21400627
  33. Data show that TRPV5 and TRPV6 expression is decreased in preeclampsia (PE). PMID: 20178461
  34. TRPV6 is involved not only in calcium transport but also in the transport of other divalent cations, including heavy metal ions, which may have toxicological implications. PMID: 21146870
  35. Endogenous TRPV6 channels are activated downstream of a G protein-coupled receptor, providing the first physiological characterization of these channels in situ. PMID: 21349844
  36. Individuals in non-African areas with the allele containing 3 derived nonsynonymous SNPs (157C, 378M, 681M) in the gene encoding calcium-permeable TRPV6 (derived-TRPV6) may absorb higher Ca(2+) from the intestine compared to individuals in Africa with the ancestral-TRPV6 allele. PMID: 20948163
  37. Quercetin aglycon supplementation stimulates TRPV6 gene expression in the upper small intestine, leading to improved calcium absorption from the epithelium. PMID: 21228504
  38. Studies indicate that TRPV6 was present in prostate cancer (PCa) tissue specimens and in lymph node metastasis, but not in benign prostatic hyperplasia (BPH) or normal prostate tissue. PMID: 20730379
  39. TRPV6-targeted siRNA can inhibit TRPV6 transcription, suppressing proliferation, arresting the cell cycle, and inducing apoptosis in LNCaP cells. PMID: 20684323
  40. The retinal pigment epithelium expresses the epithelial calcium channels TRPV5 and TRPV6, the most calcium-selective channels within the TRP superfamily. PMID: 20405023
  41. Data conclude that PIKfyve participates in the regulation of TRPV6. PMID: 20041238
  42. While expression of trpv6 transcripts correlates with the aggressive potential of prostate cancer, the TRPV6 genotype does not correlate with the onset of prostate cancer. PMID: 19857260
  43. 1,25-Dihydroxyvitamin D3 increases mRNA expression of the CaT1 calcium channel in the Caco-2 intestinal cell line. PMID: 11545681
  44. This research aimed to characterize ECaC2 in greater detail and compare its properties with those of Ecac1 to gain a better understanding of transcellular Ca2+ transport in epithelia. PMID: 11744752
  45. A regulatory component that controls the activation of both CaT1 and CRAC (Ca(2+) release-activated Ca(2+) channel) channels has been identified. PMID: 12011062
  46. The role of TRPV6 as a calcium sensor in rat and human cells has been investigated. PMID: 12138163
  47. CaT1 is the channel protein that contributes to T-lymphocyte store-operated Ca(2+) channels either alone or as a subunit in a heterogeneous channel complex. PMID: 12361955
  48. Our results suggest that the expression pattern of CaT1 and CaT2 correlates with the Ca2+ uptake potential during the differentiation of cultured human trophoblasts isolated from term placenta. PMID: 12390878
  49. The role of CaT1 in generating endogenous store-operated Ca(2+) current (I(SOC)) in the lymph node carcinoma of the prostate (LNCaP) human prostate cancer epithelial cell line has been explored. PMID: 12584203
  50. The effects of intracellular Mg(2+) on TRPV6 partially resemble the gating mechanism of inwardly rectifying K(+) channels and may represent a novel regulatory mechanism for TRPV6 function in vivo. PMID: 12601087

Show More

Hide All

Database Links

HGNC: 14006

OMIM: 606680

KEGG: hsa:55503

STRING: 9606.ENSP00000352358

UniGene: Hs.302740

Protein Families
Transient receptor (TC 1.A.4) family, TrpV subfamily, TRPV6 sub-subfamily
Subcellular Location
Cell membrane; Multi-pass membrane protein.
Tissue Specificity
Expressed at high levels in the gastrointestinal tract, including esophagus, stomach, duodenum, jejunum, ileum and colon, and in pancreas, placenta, prostate and salivary gland. Expressed at moderate levels in liver, kidney and testis. Expressed in tropho

Q&A

What epitopes are most effective for generating specific TRPV6 antibodies?

Epitope selection is critical for TRPV6 antibody specificity. Research shows that targeting unique regions within the TRPV6 protein sequence yields varying results. A comprehensive study analyzed the entire TRPV6 protein sequence from UniProt (Q9H1D0) and designed four unique epitopes covering distinct domains:

  • N-terminus (rb80)

  • Extracellular loop (X-loop) (rb79)

  • Pore region (rb82)

  • C-terminus (rb81)

Among these, antibodies against the extracellular loop (rb79) demonstrated superior specificity, consistently detecting the full-length glycosylated form of TRPV6 at approximately 95-100 kDa (the theoretical size of unglycosylated protein is 87.3 kDa) . When designing your antibody, prioritize unique sequences with minimal homology to related proteins, particularly TRPV5, which shares significant sequence similarity with TRPV6 .

What methods are most reliable for validating TRPV6 antibody specificity?

Validated TRPV6 antibodies must undergo rigorous specificity testing through multiple complementary approaches:

  • siRNA knockdown validation: Transfect cells with siRNAs targeting different exons of TRPV6 mRNA (exons 1, 7, 11, and 13) and confirm reduced protein levels via immunoblotting compared to control siRNA (e.g., luciferase) .

  • Overexpression systems: Transfect cells with TRPV6 expression vectors and verify increased band intensity at the expected molecular weight .

  • Knockout cell line testing: Compare antibody reactivity in wild-type versus TRPV6 knockout cell lines (e.g., HAP-1 trpv6−/−) .

  • Immunoprecipitation: Confirm antibody specificity through enrichment of TRPV6 protein from cell lysates .

  • Immunofluorescence co-localization: Transfect cells with TRPV6-YFP fusion protein and quantify co-localization with antibody staining (>70% co-localization indicates specificity) .

For comprehensive validation, combine these approaches rather than relying on a single method.

How can I distinguish between TRPV6 and its close homolog TRPV5 when testing antibody specificity?

Distinguishing TRPV6 from TRPV5 requires careful consideration of epitope selection and validation methods:

  • Epitope selection: Choose sequences with minimal homology between TRPV6 and TRPV5. Research has identified that antibodies targeting the extracellular loop (X-loop) can have approximately four mismatches between TRPV6 and the homologous sequence in TRPV5, providing sufficient differentiation .

  • Discriminative PCR primer design: Develop primer pairs that specifically amplify either TRPV6 or TRPV5. This approach allows verification at the mRNA level before protein analysis .

  • Expression pattern analysis: TRPV6 and TRPV5 show distinct tissue expression patterns. In TRPV6 knockout models, analysis of TRPV5 expression can help identify potential cross-reactivity .

  • Western blot molecular weight differentiation: While similar in size, careful analysis of band patterns can help distinguish between these proteins, as glycosylation patterns may differ .

When validating an antibody claimed to be TRPV6-specific, always test for potential cross-reactivity with TRPV5, especially in tissues known to express both channels.

What are the optimal conditions for using TRPV6 antibodies in immunohistochemistry of paraffin-embedded cancer specimens?

For optimal immunohistochemical detection of TRPV6 in paraffin-embedded cancer specimens:

  • Antigen retrieval: Heat-induced epitope retrieval in citrate buffer (pH 6.0) is essential for unmasking TRPV6 epitopes after formalin fixation.

  • Antibody selection: Polyclonal antibody rb79 (targeting the extracellular loop) and monoclonal antibody mAb82 have demonstrated reliable performance in paraffin-embedded sections .

  • Dilution optimization: Titrate antibody concentrations between 1:100 to 1:500 to determine optimal signal-to-noise ratio.

  • Validation controls: Include known TRPV6-positive tissues (e.g., prostate cancer specimens) and TRPV6-negative tissues (e.g., normal prostate tissue) as controls .

  • Detection system: A polymer-based detection system often yields better results than avidin-biotin methods for TRPV6 detection.

Importantly, TRPV6 immunohistochemistry has demonstrated value in discriminating between normal and cancerous prostate tissue, with expression correlating with cancer grade . This makes it a potentially valuable diagnostic tool when properly optimized.

How can TRPV6 antibodies be used to investigate calcium signaling pathways in cancer cells?

TRPV6 antibodies serve as powerful tools for investigating calcium signaling in cancer through multiple approaches:

  • Functional blockade experiments: Antibodies targeting the extracellular domains or pore region (e.g., mAb82) can modulate channel function, allowing investigation of calcium-dependent signaling pathways .

  • Co-immunoprecipitation assays: Use TRPV6 antibodies to identify protein interaction partners within calcium signaling complexes. The rb79 antibody has demonstrated effectiveness in immunoprecipitation experiments, revealing both glycosylated and non-glycosylated forms of TRPV6 .

  • Calcium imaging combined with antibody treatment: Apply TRPV6-specific antibodies during calcium imaging experiments to determine the specific contribution of TRPV6 to calcium influx.

  • Pathway analysis: Research has shown that TRPV6 expression influences multiple gene expression pathways. Downstream targets upregulated by TRPV6 include col6a6, timp3, znf718, reg4, fzd7, pcdh1, while downregulated targets include hcls1, magea11, and fabp6 .

These approaches allow researchers to dissect the specific role of TRPV6 in calcium-dependent processes like proliferation, migration, and therapy resistance in cancer cells.

What experimental designs best demonstrate TRPV6 antibody specificity in immunofluorescence applications?

To rigorously validate TRPV6 antibody specificity in immunofluorescence:

  • Fluorescent protein fusion co-localization: Transfect cells with TRPV6-YFP fusion constructs, then perform immunofluorescence with the TRPV6 antibody. Quantify co-localization using appropriate software (e.g., Zeiss Zen). Research shows that specific antibodies like rb79 achieve >70% co-localization with TRPV6-YFP, compared to only 18% with control proteins .

  • Expression level comparison: Test the antibody in a panel of cells with varying TRPV6 expression levels (e.g., HAP-1 trpv6+/+ cells show approximately 24.58% TRPV6-positive cells at the plasma membrane versus 3.8% in HAP-1 trpv6−/− cells) .

  • siRNA knockdown validation: Perform immunofluorescence in parallel on control and TRPV6 siRNA-treated cells to confirm signal reduction.

  • Blocking peptide competition: Pre-incubate the antibody with the immunizing peptide before application to cells to demonstrate signal abolishment.

  • Alternative antibody confirmation: When possible, validate findings with a second antibody targeting a different TRPV6 epitope.

Employ quantitative metrics (intensity measurements, co-localization coefficients) rather than subjective visual assessment to objectively evaluate antibody specificity.

What is the normal tissue distribution of TRPV6 protein and how does it compare to expression in cancerous tissues?

TRPV6 protein expression shows a tissue-specific distribution pattern with notable differences between normal and cancerous tissues:

Normal tissues with significant TRPV6 expression:

  • Placenta (particularly during later stages of pregnancy)

  • Salivary gland (basolateral membrane of acinar cells)

  • Endometrium (varies during menstrual cycle)

  • Duodenum and intestinal epithelia (moderate expression)

Normal tissues with minimal/no TRPV6 expression:

  • Healthy prostate (produces very little, if any, TRPV6)

  • Liver (TRPV6 protein not detected)

  • Lung (low levels in epithelial cells)

The table below shows relative TRPV6 expression across various tissues:

TissueExpression Level
PlacentaHigh (17)
Salivary glandHigh (37)
ProstateVariable (0-56, high in cancer)
PancreasModerate (10-26)
IntestineLow-Moderate (0.2-16)
LiverVery Low (0-3)
TestesLow (0.7-2)
LungLow (3-6)

In cancerous tissues, TRPV6 is frequently upregulated, particularly in prostate cancer, where expression correlates with cancer grade. Immunohistochemical studies have confirmed this differential expression pattern, making TRPV6 detection a potential diagnostic tool .

What are the most reliable RT-PCR protocols for quantifying TRPV6 expression to validate antibody findings?

For reliable RT-PCR quantification of TRPV6 expression:

  • RNA isolation method: Use specialized kits like NucleoSpin® RNA Plus (Macherey-Nagel) that ensure high-quality RNA extraction with minimal degradation .

  • qPCR reagents: MESA GREEN qPCR MasterMix Plus for SYBR Assay (Eurogentec) has demonstrated reliable results for TRPV6 detection .

  • Primer selection: The following validated primer sequences have been used successfully:

    • TRPV6: 5′-CCCAAGGAGAAAGGGCTAAT-3′ and 5′-TTGGCAGCTAGAAGGAGAGG-3′

    • GAPDH (reference gene): 5′-CTGTTGTGCTCTTGCTGGG-3′ and 5′-ACCCACTCCTCCACCTTTG-3′

  • Quantification method: Use the comparative threshold cycle method (ΔΔCt) with appropriate software (e.g., Bio-Rad CFX Manager Software v2.0) .

  • Multiple reference genes: For increased reliability, normalize against multiple housekeeping genes (e.g., GAPDH, HPRT) to account for potential expression variations .

  • Splice variant consideration: Design primers that can detect all TRPV6 splice variants or specific primers to distinguish between variants, particularly when investigating tissues with potential alternative splicing .

This approach provides quantitative data on TRPV6 mRNA expression that can be correlated with protein levels detected via antibody-based methods.

How can flow cytometry be optimized for TRPV6 antibody validation and expression analysis?

Optimizing flow cytometry for TRPV6 detection requires attention to several key parameters:

  • Cell preparation: Preserve membrane integrity during fixation and permeabilization. For TRPV6, a mild fixation (2% paraformaldehyde for 10 minutes) followed by gentle permeabilization (0.1% saponin) helps maintain epitope accessibility.

  • Antibody selection: Choose antibodies targeting extracellular epitopes (like rb79 or mAb82) for live cell staining, or antibodies against intracellular epitopes for fixed/permeabilized cells .

  • Positive controls: Include cells with confirmed high TRPV6 expression (e.g., LNCaP cells or TRPV6-transfected cell lines) .

  • Negative controls: Use matched isotype controls and TRPV6-knockout or siRNA-treated cells to establish background staining levels .

  • Gating strategy: First gate on viable cells (using appropriate viability dye), then on single cells, before analyzing TRPV6 expression.

  • Quantification benchmark: Express results as percentage of positive cells and mean fluorescence intensity (MFI). Research has shown approximately 24.58% TRPV6-positive cells at the plasma membrane in HAP-1 trpv6+/+ cells versus 3.8% in HAP-1 trpv6−/− cells .

Flow cytometry provides quantitative data on TRPV6 expression at the single-cell level, complementing Western blot and immunofluorescence approaches.

How effective are TRPV6 antibodies in inhibiting calcium-dependent cancer cell processes?

TRPV6 antibodies show promising effectiveness in inhibiting calcium-dependent cancer cell processes:

  • Functional inhibition: Monoclonal antibodies targeting the pore region, such as mAb82, have demonstrated the ability to functionally block TRPV6 channels, reducing calcium influx in cancer cells .

  • Growth inhibition: Treatment with TRPV6-targeting antibodies has been shown to induce apoptosis in cancer cells expressing high levels of TRPV6, particularly in prostate cancer models .

  • Mechanism of action: TRPV6 antibodies work by disrupting aberrant calcium homeostasis that is required by many cancers. This disruption impacts multiple downstream signaling pathways critical for cancer cell survival and proliferation .

  • Target specificity: The effectiveness correlates with TRPV6 expression levels, making these antibodies particularly valuable for cancers with high TRPV6 expression, such as advanced prostate cancer .

The research suggests that TRPV6 is "clearly a valid target to disrupt further the aberrant calcium homeostasis observed in and required by many cancers" , and antibodies specifically targeting this channel show promise as potential therapeutic agents.

What methodological considerations are important when using TRPV6 antibodies for in vivo cancer studies?

When designing in vivo studies using TRPV6 antibodies:

  • Antibody format selection: Monoclonal antibodies like mAb82 have demonstrated efficacy in vivo for treating TRPV6-expressing prostate cancer tumors . Full IgG formats typically offer longer half-lives compared to antibody fragments.

  • Dosing regimen optimization: Establish dose-response relationships in vitro before proceeding to in vivo studies to determine effective antibody concentrations.

  • Tumor model selection: Choose models with verified TRPV6 expression that recapitulates clinical situations. Research has validated TRPV6 expression in prostate cancer patient samples through immunohistochemistry .

  • Antibody validation: Confirm the antibody specifically detects human TRPV6 at the expected molecular weight (approximately 95 kDa for the glycosylated form) .

  • Biodistribution analysis: Assess antibody distribution using labeled antibodies to confirm tumor targeting and potential off-target binding in tissues with normal TRPV6 expression.

  • Combinatorial approaches: Consider combining TRPV6 antibodies with standard therapies to enhance efficacy, as TRPV6 has been implicated in therapy resistance pathways .

These methodological considerations enhance the translational relevance of in vivo studies targeting TRPV6 in cancer.

How can TRPV6 antibodies be used to stratify patients for personalized cancer therapy approaches?

TRPV6 antibodies offer valuable tools for patient stratification in personalized oncology:

  • Diagnostic application: Validated antibodies like rb79 and mAb82 can be used for immunohistochemical analysis of patient tumor samples to determine TRPV6 expression levels .

  • Correlation with disease progression: Research demonstrates that TRPV6 expression correlates with prostate cancer grades, allowing stratification of patients based on expression patterns .

  • Therapy response prediction: TRPV6 expression influences multiple pathways related to tumor progression and drug resistance in castration-resistant prostate cancer . This suggests TRPV6 expression status could predict response to both TRPV6-targeted and conventional therapies.

  • Potential biomarker panels: Combine TRPV6 staining with assessment of downstream targets influenced by TRPV6 expression (e.g., col6a6, timp3, znf718, fzd7) for more comprehensive patient stratification.

  • Calcium signaling assessment: Functional assays using TRPV6 antibodies could potentially assess calcium channel activity in patient-derived samples, providing additional stratification criteria.

This approach could identify patients most likely to benefit from TRPV6-targeted therapies or combination treatments, advancing the field toward more personalized cancer treatment strategies.

Why might different TRPV6 antibodies yield inconsistent results in the same experimental system?

Inconsistencies between TRPV6 antibodies often stem from multiple factors:

  • Epitope differences: Research has demonstrated that antibodies targeting different TRPV6 epitopes (N-terminus, X-loop, pore region, C-terminus) yield dramatically different results. Only the rb79 antibody (targeting the X-loop) reliably detected the expected 95-100 kDa glycosylated TRPV6 protein, while others showed bands at unexpected sizes (160 kDa, 80 kDa) or multiple non-specific bands .

  • Cross-reactivity with TRPV5: TRPV6 shares strong homology with TRPV5, making cross-reactivity common. The rb79 antibody sequence has four mismatches with the homologous TRPV5 sequence, providing specificity .

  • Post-translational modifications: TRPV6 undergoes glycosylation, yielding a ~95-100 kDa protein rather than the theoretical 87.3 kDa unglycosylated form. Antibodies may detect different glycosylation states with varying efficiency .

  • Application-specific performance: An antibody performing well in Western blotting may fail in immunoprecipitation or immunohistochemistry due to epitope accessibility differences in various applications .

  • Experimental conditions: Variations in fixation, permeabilization, blocking, or detection methods can significantly impact antibody performance and specificity .

To address these inconsistencies, validate each antibody thoroughly across multiple techniques and include appropriate controls for each application.

What are the most common pitfalls in TRPV6 antibody validation and how can they be avoided?

Common pitfalls in TRPV6 antibody validation include:

  • Inadequate specificity testing: Many commercial antibodies lack thorough validation. Implement comprehensive validation using siRNA knockdown, overexpression systems, and knockout cell lines .

  • Reliance on single validation method: Research demonstrates that some antibodies appear specific in one application but fail in others. For instance, band detection at expected molecular weight doesn't guarantee specificity without knockdown confirmation .

  • Ignoring potential TRPV5 cross-reactivity: Given the high homology between TRPV6 and TRPV5, antibodies claiming TRPV6 specificity may detect both. Design discriminative PCR primers to verify the presence of either channel at the mRNA level before protein analysis .

  • Misinterpretation of bands: The study identified that unspecific bands (e.g., ~50 kDa) can appear in Western blots but disappear during immunoprecipitation. Confirm that detected bands correspond to expected TRPV6 size and behavior .

  • Overlooking detection of splice variants: TRPV6 may have splice variants in different tissues. Design experiments to detect potential variants and verify which forms your antibody recognizes .

To avoid these pitfalls, implement thorough validation protocols including multiple techniques, appropriate controls, and comparative analysis with established research findings.

How can researchers resolve contradictory results between TRPV6 mRNA expression and protein detection?

When facing discrepancies between TRPV6 mRNA and protein detection:

  • Verify RNA integrity and primer specificity: Ensure RNA is intact and primers specifically detect TRPV6 without amplifying TRPV5 or other homologs. Research has validated specific primers for discriminating between these channels .

  • Check for post-transcriptional regulation: TRPV6 may be subject to microRNA regulation or nonsense-mediated mRNA decay (NMDA). In the HAP-1 knockout model, researchers observed NMDA affecting TRPV6 mRNA levels .

  • Assess protein turnover rates: Rapid protein degradation despite robust mRNA expression can cause discrepancies. Treat cells with proteasome inhibitors to evaluate this possibility.

  • Examine post-translational modifications: TRPV6 undergoes glycosylation, producing a 95-100 kDa protein rather than the theoretical 87.3 kDa. Ensure antibodies can detect relevant modified forms .

  • Consider antibody limitations: Some antibodies may not detect all TRPV6 isoforms or may have limited sensitivity. Compare results using multiple antibodies targeting different epitopes .

  • Evaluate alternative splicing: Design PCR primers to detect potential splice variants. Research has shown that in some cell models, certain fragments (e.g., 5'-UTR) may not be expressed, potentially affecting protein detection .

These strategies help reconcile contradictory findings between mRNA expression and protein detection, providing more reliable data on TRPV6 biology in research contexts.

Quick Inquiry

Personal Email Detected
Please use an institutional or corporate email address for inquiries. Personal email accounts ( such as Gmail, Yahoo, and Outlook) are not accepted. *
© Copyright 2025 TheBiotek. All Rights Reserved.