TRPV6 is a highly selective calcium channel that normally functions in calcium absorption in the intestine and kidney. It belongs to the vanilloid family of transient receptor potential calcium channel proteins, which are characterized by an N-terminal ankyrin repeat domain essential for channel assembly and regulation . The significance of TRPV6 extends beyond normal physiology into pathological contexts, particularly cancer, where it has been identified as an "oncochannel" overexpressed in various epithelial malignancies .
Research has revealed that TRPV6 is expressed de novo in prostate cancer cells, where it alters calcium homeostasis to increase cancer cell survival by enhancing proliferation and conferring resistance to apoptosis . This association with cancer progression has intensified interest in developing reliable antibodies that can accurately detect and study TRPV6 in both research and clinical settings.
A significant advancement in TRPV6 research came with the development of rabbit polyclonal antibodies targeting specific epitopes of the TRPV6 channel. Researchers analyzed the complete TRPV6 protein sequence from UniProt (Q9H1D0) and designed four unique epitopes covering distinct domains: the N-terminus, X-loop, pore region, and C-terminus .
The generation process involved the AS-SMAF-SINGLE Rabbit—Speedy 28 days program, with antigens synthesized specifically for each target domain. The resulting antibodies were designated as follows:
rb80: targeting the N-terminus
rb79: targeting the extracellular loop (X-loop)
rb82: targeting the pore region
The immune response was carefully monitored by comparing dilutions of pre-immune serum (collected before immunization) with large bleed samples (obtained 21 days post-immunization). Due to the complexity and low antigenicity of the pore antigen, researchers implemented an extended 87-day program with additional weekly boosts for the rb82 antibody .
Validation of TRPV6 antibodies typically begins with immunoblotting to confirm specificity and determine the molecular weight of the detected protein. For instance, when testing the rb79 antibody on total lysates from LNCaP, DU-145, PC-3, and PC-3M prostate cancer cell lines, researchers observed the expected glycosylated form of the protein at approximately 95-100 kDa, compared to the theoretical size of 87.3 kDa for the unglycosylated protein .
During validation, it's common to encounter non-specific bands, as was the case with a 50 kDa band detected in some experiments. Identifying and characterizing such non-specific interactions is crucial for ensuring accurate interpretation of results in subsequent applications .
A more rigorous validation approach involves small interfering RNA (siRNA) knockdown experiments to confirm antibody specificity. Researchers employed four different siRNAs targeting various exons of TRPV6 mRNA to validate the rb79 antibody. The siRNA sequences used included:
| Target and Accession Number | Sequence |
|---|---|
| TRPV6 siRNA-1 (NM_018646) | 5′-CCUGCUGCAGCAGAAGAGG (dTdT)-3′ |
These siRNAs achieved more than 60% knockdown efficiency at the mRNA level, as confirmed by quantitative real-time PCR. This reduction in mRNA expression corresponded with decreased protein levels detected by immunoblotting with the rb79 antibody, confirming its specificity for TRPV6 .
Immunoprecipitation provides another method to validate antibody specificity while demonstrating its utility for this application. When researchers performed immunoprecipitation with the rb79 antibody on LNCaP cell lysates, they observed two distinct bands corresponding to glycosylated and non-glycosylated forms of TRPV6. Interestingly, the non-specific 50 kDa band observed in direct immunoblotting disappeared in immunoprecipitation samples, further supporting the specificity of rb79 for TRPV6 .
TRPV6 antibodies are routinely used in immunoblotting to detect and quantify TRPV6 protein expression across various cell types and tissues. For optimal results with commercial antibodies like bs-15506R, recommended dilutions range from 1:300 to 1:5000, depending on the specific sample and detection method .
Primers used for validating TRPV6 expression at the mRNA level before immunoblotting include:
| Accession Number | Forward Primer | Backward Primer | Expected Size (b.p) |
|---|---|---|---|
| TRPV6, NM_018646 | CCCTCAGTGTCTCGAAGTAC | TCAGATCTGATATTCCCAGCTC | 134 |
| TRPV6, NM_018646 | CCCAAGGAGAAAGGGCTAAT | TTGGCAGCTAGAAGGAGAGG | 145 |
One of the most valuable applications of TRPV6 antibodies is immunohistochemistry on tissue samples, particularly paraffin-embedded sections from cancer resection specimens. Using prostate cancer tissues, researchers have demonstrated that TRPV6 protein is absent in healthy prostate tissue and benign hyperplasia but present in cancerous tissue, with expression levels correlating with cancer grade .
For immunohistochemistry applications, commercial antibodies typically recommend dilutions of 1:200-400 for paraffin-embedded sections (IHC-P) and 1:100-500 for frozen sections (IHC-F) .
TRPV6 antibodies targeting extracellular epitopes, such as rb79, are particularly useful for detecting TRPV6 channels on the cell surface using immunofluorescence. In non-permeabilized cells, these antibodies can exclusively stain plasma membrane-localized TRPV6, providing valuable information about channel trafficking and localization .
Additionally, TRPV6 antibodies can be employed in flow cytometry (FACS) for quantitative analysis of TRPV6 expression in cell populations. For immunofluorescence applications, typical dilutions range from 1:50 to 1:200, while flow cytometry generally requires dilutions of 1:20 to 1:100 .
| Application | Recommended Dilution |
|---|---|
| Immunoblotting (WB) | 1:300-5000 |
| ELISA | 1:500-1000 |
| Flow Cytometry (FCM) | 1:20-100 |
| Immunohistochemistry (IHC-P) | 1:200-400 |
| Immunohistochemistry (IHC-F) | 1:100-500 |
| Immunofluorescence (IHC-P) | 1:50-200 |
| Immunofluorescence (IHC-F) | 1:50-200 |
| Immunofluorescence (ICC) | 1:50-200 |
| Immunocytochemistry (ICC) | 1:100-500 |
TRPV6 antibodies have proven instrumental in establishing TRPV6 as a potential biomarker in cancer research. Studies utilizing these antibodies have demonstrated that TRPV6 is overexpressed in various epithelial cancers, particularly prostate cancer, where it functions as an "oncochannel" .
Immunohistochemical analysis of xenograft tumors in nude mice using TRPV6 antibodies has revealed correlations between TRPV6 expression and other clinical markers associated with poor prognosis, including Ki-67, prostate-specific antigen, synaptophysin, CD31, and CD56 . These findings suggest that TRPV6 antibodies may have diagnostic and prognostic value in clinical oncology.
TRPV6 antibodies have helped elucidate the mechanisms by which TRPV6 contributes to cancer progression. Research has shown that TRPV6 mediates calcium entry in prostate cancer cells through a remodeling mechanism involving the translocation of TRPV6 channels to the plasma membrane via the Orai1/TRPC1-mediated calcium/Annexin I/S100A11 pathway .
This mechanistic insight has led to the development of first-in-class TRPV6 inhibitors for potential cancer treatment, such as QED-203, which has demonstrated inhibition of calcium influx at low nanomolar potency in TRPV6 cellular assays . As these therapeutic approaches advance, TRPV6 antibodies will continue to play a crucial role in validating target engagement and monitoring treatment response.
The development of novel TRPV6 antibodies continues to be an active area of research, driven by the growing recognition of TRPV6's importance in cancer biology and its potential as a therapeutic target. Current research focuses on several key areas:
Development of monoclonal antibodies with enhanced specificity for various TRPV6 epitopes
Creation of antibodies suitable for in vivo imaging of TRPV6-expressing tumors
Exploration of therapeutic antibodies targeting TRPV6 for cancer treatment
Investigation of TRPV6 antibodies as companion diagnostics for TRPV6-targeted therapies
These ongoing efforts aim to expand the toolkit available for studying TRPV6 in various contexts and to translate basic research findings into clinical applications.
Epitope selection is critical for TRPV6 antibody specificity. Research shows that targeting unique regions within the TRPV6 protein sequence yields varying results. A comprehensive study analyzed the entire TRPV6 protein sequence from UniProt (Q9H1D0) and designed four unique epitopes covering distinct domains:
Among these, antibodies against the extracellular loop (rb79) demonstrated superior specificity, consistently detecting the full-length glycosylated form of TRPV6 at approximately 95-100 kDa (the theoretical size of unglycosylated protein is 87.3 kDa) . When designing your antibody, prioritize unique sequences with minimal homology to related proteins, particularly TRPV5, which shares significant sequence similarity with TRPV6 .
Validated TRPV6 antibodies must undergo rigorous specificity testing through multiple complementary approaches:
siRNA knockdown validation: Transfect cells with siRNAs targeting different exons of TRPV6 mRNA (exons 1, 7, 11, and 13) and confirm reduced protein levels via immunoblotting compared to control siRNA (e.g., luciferase) .
Overexpression systems: Transfect cells with TRPV6 expression vectors and verify increased band intensity at the expected molecular weight .
Knockout cell line testing: Compare antibody reactivity in wild-type versus TRPV6 knockout cell lines (e.g., HAP-1 trpv6−/−) .
Immunoprecipitation: Confirm antibody specificity through enrichment of TRPV6 protein from cell lysates .
Immunofluorescence co-localization: Transfect cells with TRPV6-YFP fusion protein and quantify co-localization with antibody staining (>70% co-localization indicates specificity) .
For comprehensive validation, combine these approaches rather than relying on a single method.
Distinguishing TRPV6 from TRPV5 requires careful consideration of epitope selection and validation methods:
Epitope selection: Choose sequences with minimal homology between TRPV6 and TRPV5. Research has identified that antibodies targeting the extracellular loop (X-loop) can have approximately four mismatches between TRPV6 and the homologous sequence in TRPV5, providing sufficient differentiation .
Discriminative PCR primer design: Develop primer pairs that specifically amplify either TRPV6 or TRPV5. This approach allows verification at the mRNA level before protein analysis .
Expression pattern analysis: TRPV6 and TRPV5 show distinct tissue expression patterns. In TRPV6 knockout models, analysis of TRPV5 expression can help identify potential cross-reactivity .
Western blot molecular weight differentiation: While similar in size, careful analysis of band patterns can help distinguish between these proteins, as glycosylation patterns may differ .
When validating an antibody claimed to be TRPV6-specific, always test for potential cross-reactivity with TRPV5, especially in tissues known to express both channels.
For optimal immunohistochemical detection of TRPV6 in paraffin-embedded cancer specimens:
Antigen retrieval: Heat-induced epitope retrieval in citrate buffer (pH 6.0) is essential for unmasking TRPV6 epitopes after formalin fixation.
Antibody selection: Polyclonal antibody rb79 (targeting the extracellular loop) and monoclonal antibody mAb82 have demonstrated reliable performance in paraffin-embedded sections .
Dilution optimization: Titrate antibody concentrations between 1:100 to 1:500 to determine optimal signal-to-noise ratio.
Validation controls: Include known TRPV6-positive tissues (e.g., prostate cancer specimens) and TRPV6-negative tissues (e.g., normal prostate tissue) as controls .
Detection system: A polymer-based detection system often yields better results than avidin-biotin methods for TRPV6 detection.
Importantly, TRPV6 immunohistochemistry has demonstrated value in discriminating between normal and cancerous prostate tissue, with expression correlating with cancer grade . This makes it a potentially valuable diagnostic tool when properly optimized.
TRPV6 antibodies serve as powerful tools for investigating calcium signaling in cancer through multiple approaches:
Functional blockade experiments: Antibodies targeting the extracellular domains or pore region (e.g., mAb82) can modulate channel function, allowing investigation of calcium-dependent signaling pathways .
Co-immunoprecipitation assays: Use TRPV6 antibodies to identify protein interaction partners within calcium signaling complexes. The rb79 antibody has demonstrated effectiveness in immunoprecipitation experiments, revealing both glycosylated and non-glycosylated forms of TRPV6 .
Calcium imaging combined with antibody treatment: Apply TRPV6-specific antibodies during calcium imaging experiments to determine the specific contribution of TRPV6 to calcium influx.
Pathway analysis: Research has shown that TRPV6 expression influences multiple gene expression pathways. Downstream targets upregulated by TRPV6 include col6a6, timp3, znf718, reg4, fzd7, pcdh1, while downregulated targets include hcls1, magea11, and fabp6 .
These approaches allow researchers to dissect the specific role of TRPV6 in calcium-dependent processes like proliferation, migration, and therapy resistance in cancer cells.
To rigorously validate TRPV6 antibody specificity in immunofluorescence:
Fluorescent protein fusion co-localization: Transfect cells with TRPV6-YFP fusion constructs, then perform immunofluorescence with the TRPV6 antibody. Quantify co-localization using appropriate software (e.g., Zeiss Zen). Research shows that specific antibodies like rb79 achieve >70% co-localization with TRPV6-YFP, compared to only 18% with control proteins .
Expression level comparison: Test the antibody in a panel of cells with varying TRPV6 expression levels (e.g., HAP-1 trpv6+/+ cells show approximately 24.58% TRPV6-positive cells at the plasma membrane versus 3.8% in HAP-1 trpv6−/− cells) .
siRNA knockdown validation: Perform immunofluorescence in parallel on control and TRPV6 siRNA-treated cells to confirm signal reduction.
Blocking peptide competition: Pre-incubate the antibody with the immunizing peptide before application to cells to demonstrate signal abolishment.
Alternative antibody confirmation: When possible, validate findings with a second antibody targeting a different TRPV6 epitope.
Employ quantitative metrics (intensity measurements, co-localization coefficients) rather than subjective visual assessment to objectively evaluate antibody specificity.
TRPV6 protein expression shows a tissue-specific distribution pattern with notable differences between normal and cancerous tissues:
Normal tissues with significant TRPV6 expression:
Normal tissues with minimal/no TRPV6 expression:
The table below shows relative TRPV6 expression across various tissues:
| Tissue | Expression Level |
|---|---|
| Placenta | High (17) |
| Salivary gland | High (37) |
| Prostate | Variable (0-56, high in cancer) |
| Pancreas | Moderate (10-26) |
| Intestine | Low-Moderate (0.2-16) |
| Liver | Very Low (0-3) |
| Testes | Low (0.7-2) |
| Lung | Low (3-6) |
In cancerous tissues, TRPV6 is frequently upregulated, particularly in prostate cancer, where expression correlates with cancer grade. Immunohistochemical studies have confirmed this differential expression pattern, making TRPV6 detection a potential diagnostic tool .
For reliable RT-PCR quantification of TRPV6 expression:
RNA isolation method: Use specialized kits like NucleoSpin® RNA Plus (Macherey-Nagel) that ensure high-quality RNA extraction with minimal degradation .
qPCR reagents: MESA GREEN qPCR MasterMix Plus for SYBR Assay (Eurogentec) has demonstrated reliable results for TRPV6 detection .
Primer selection: The following validated primer sequences have been used successfully:
Quantification method: Use the comparative threshold cycle method (ΔΔCt) with appropriate software (e.g., Bio-Rad CFX Manager Software v2.0) .
Multiple reference genes: For increased reliability, normalize against multiple housekeeping genes (e.g., GAPDH, HPRT) to account for potential expression variations .
Splice variant consideration: Design primers that can detect all TRPV6 splice variants or specific primers to distinguish between variants, particularly when investigating tissues with potential alternative splicing .
This approach provides quantitative data on TRPV6 mRNA expression that can be correlated with protein levels detected via antibody-based methods.
Optimizing flow cytometry for TRPV6 detection requires attention to several key parameters:
Cell preparation: Preserve membrane integrity during fixation and permeabilization. For TRPV6, a mild fixation (2% paraformaldehyde for 10 minutes) followed by gentle permeabilization (0.1% saponin) helps maintain epitope accessibility.
Antibody selection: Choose antibodies targeting extracellular epitopes (like rb79 or mAb82) for live cell staining, or antibodies against intracellular epitopes for fixed/permeabilized cells .
Positive controls: Include cells with confirmed high TRPV6 expression (e.g., LNCaP cells or TRPV6-transfected cell lines) .
Negative controls: Use matched isotype controls and TRPV6-knockout or siRNA-treated cells to establish background staining levels .
Gating strategy: First gate on viable cells (using appropriate viability dye), then on single cells, before analyzing TRPV6 expression.
Quantification benchmark: Express results as percentage of positive cells and mean fluorescence intensity (MFI). Research has shown approximately 24.58% TRPV6-positive cells at the plasma membrane in HAP-1 trpv6+/+ cells versus 3.8% in HAP-1 trpv6−/− cells .
Flow cytometry provides quantitative data on TRPV6 expression at the single-cell level, complementing Western blot and immunofluorescence approaches.
TRPV6 antibodies show promising effectiveness in inhibiting calcium-dependent cancer cell processes:
Functional inhibition: Monoclonal antibodies targeting the pore region, such as mAb82, have demonstrated the ability to functionally block TRPV6 channels, reducing calcium influx in cancer cells .
Growth inhibition: Treatment with TRPV6-targeting antibodies has been shown to induce apoptosis in cancer cells expressing high levels of TRPV6, particularly in prostate cancer models .
Mechanism of action: TRPV6 antibodies work by disrupting aberrant calcium homeostasis that is required by many cancers. This disruption impacts multiple downstream signaling pathways critical for cancer cell survival and proliferation .
Target specificity: The effectiveness correlates with TRPV6 expression levels, making these antibodies particularly valuable for cancers with high TRPV6 expression, such as advanced prostate cancer .
The research suggests that TRPV6 is "clearly a valid target to disrupt further the aberrant calcium homeostasis observed in and required by many cancers" , and antibodies specifically targeting this channel show promise as potential therapeutic agents.
When designing in vivo studies using TRPV6 antibodies:
Antibody format selection: Monoclonal antibodies like mAb82 have demonstrated efficacy in vivo for treating TRPV6-expressing prostate cancer tumors . Full IgG formats typically offer longer half-lives compared to antibody fragments.
Dosing regimen optimization: Establish dose-response relationships in vitro before proceeding to in vivo studies to determine effective antibody concentrations.
Tumor model selection: Choose models with verified TRPV6 expression that recapitulates clinical situations. Research has validated TRPV6 expression in prostate cancer patient samples through immunohistochemistry .
Antibody validation: Confirm the antibody specifically detects human TRPV6 at the expected molecular weight (approximately 95 kDa for the glycosylated form) .
Biodistribution analysis: Assess antibody distribution using labeled antibodies to confirm tumor targeting and potential off-target binding in tissues with normal TRPV6 expression.
Combinatorial approaches: Consider combining TRPV6 antibodies with standard therapies to enhance efficacy, as TRPV6 has been implicated in therapy resistance pathways .
These methodological considerations enhance the translational relevance of in vivo studies targeting TRPV6 in cancer.
TRPV6 antibodies offer valuable tools for patient stratification in personalized oncology:
Diagnostic application: Validated antibodies like rb79 and mAb82 can be used for immunohistochemical analysis of patient tumor samples to determine TRPV6 expression levels .
Correlation with disease progression: Research demonstrates that TRPV6 expression correlates with prostate cancer grades, allowing stratification of patients based on expression patterns .
Therapy response prediction: TRPV6 expression influences multiple pathways related to tumor progression and drug resistance in castration-resistant prostate cancer . This suggests TRPV6 expression status could predict response to both TRPV6-targeted and conventional therapies.
Potential biomarker panels: Combine TRPV6 staining with assessment of downstream targets influenced by TRPV6 expression (e.g., col6a6, timp3, znf718, fzd7) for more comprehensive patient stratification.
Calcium signaling assessment: Functional assays using TRPV6 antibodies could potentially assess calcium channel activity in patient-derived samples, providing additional stratification criteria.
This approach could identify patients most likely to benefit from TRPV6-targeted therapies or combination treatments, advancing the field toward more personalized cancer treatment strategies.
Inconsistencies between TRPV6 antibodies often stem from multiple factors:
Epitope differences: Research has demonstrated that antibodies targeting different TRPV6 epitopes (N-terminus, X-loop, pore region, C-terminus) yield dramatically different results. Only the rb79 antibody (targeting the X-loop) reliably detected the expected 95-100 kDa glycosylated TRPV6 protein, while others showed bands at unexpected sizes (160 kDa, 80 kDa) or multiple non-specific bands .
Cross-reactivity with TRPV5: TRPV6 shares strong homology with TRPV5, making cross-reactivity common. The rb79 antibody sequence has four mismatches with the homologous TRPV5 sequence, providing specificity .
Post-translational modifications: TRPV6 undergoes glycosylation, yielding a ~95-100 kDa protein rather than the theoretical 87.3 kDa unglycosylated form. Antibodies may detect different glycosylation states with varying efficiency .
Application-specific performance: An antibody performing well in Western blotting may fail in immunoprecipitation or immunohistochemistry due to epitope accessibility differences in various applications .
Experimental conditions: Variations in fixation, permeabilization, blocking, or detection methods can significantly impact antibody performance and specificity .
To address these inconsistencies, validate each antibody thoroughly across multiple techniques and include appropriate controls for each application.
Common pitfalls in TRPV6 antibody validation include:
Inadequate specificity testing: Many commercial antibodies lack thorough validation. Implement comprehensive validation using siRNA knockdown, overexpression systems, and knockout cell lines .
Reliance on single validation method: Research demonstrates that some antibodies appear specific in one application but fail in others. For instance, band detection at expected molecular weight doesn't guarantee specificity without knockdown confirmation .
Ignoring potential TRPV5 cross-reactivity: Given the high homology between TRPV6 and TRPV5, antibodies claiming TRPV6 specificity may detect both. Design discriminative PCR primers to verify the presence of either channel at the mRNA level before protein analysis .
Misinterpretation of bands: The study identified that unspecific bands (e.g., ~50 kDa) can appear in Western blots but disappear during immunoprecipitation. Confirm that detected bands correspond to expected TRPV6 size and behavior .
Overlooking detection of splice variants: TRPV6 may have splice variants in different tissues. Design experiments to detect potential variants and verify which forms your antibody recognizes .
To avoid these pitfalls, implement thorough validation protocols including multiple techniques, appropriate controls, and comparative analysis with established research findings.
When facing discrepancies between TRPV6 mRNA and protein detection:
Verify RNA integrity and primer specificity: Ensure RNA is intact and primers specifically detect TRPV6 without amplifying TRPV5 or other homologs. Research has validated specific primers for discriminating between these channels .
Check for post-transcriptional regulation: TRPV6 may be subject to microRNA regulation or nonsense-mediated mRNA decay (NMDA). In the HAP-1 knockout model, researchers observed NMDA affecting TRPV6 mRNA levels .
Assess protein turnover rates: Rapid protein degradation despite robust mRNA expression can cause discrepancies. Treat cells with proteasome inhibitors to evaluate this possibility.
Examine post-translational modifications: TRPV6 undergoes glycosylation, producing a 95-100 kDa protein rather than the theoretical 87.3 kDa. Ensure antibodies can detect relevant modified forms .
Consider antibody limitations: Some antibodies may not detect all TRPV6 isoforms or may have limited sensitivity. Compare results using multiple antibodies targeting different epitopes .
Evaluate alternative splicing: Design PCR primers to detect potential splice variants. Research has shown that in some cell models, certain fragments (e.g., 5'-UTR) may not be expressed, potentially affecting protein detection .
These strategies help reconcile contradictory findings between mRNA expression and protein detection, providing more reliable data on TRPV6 biology in research contexts.